Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Expression profiling of human prostate VCaP and LNCaP cancer cells after silencing ERG or ETV1, respectively

ABSTRACT: Chromosomal rearrangements involving ETS factors, ERG and ETV1, occur frequently in prostate cancer. We here examine human prostate cancer cells control VCaP and LNCaP cells with ERG- or ETV1-silenced VCaP or LNCaP cells, respectively, in hormone deprived and stimulated conditions.

ORGANISM(S): Homo sapiens

PROVIDER: GSE39354 | GEO | 2013/03/01

SECONDARY ACCESSION(S): PRJNA170744

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Similar Datasets

Expression profiling of human prostate VCaP and LNCaP cancer cells after silencing ERG or ETV1, respectively

Project description:Chromosomal rearrangements involving ETS factors, ERG and ETV1, occur frequently in prostate cancer. We here examine human prostate cancer cells control VCaP and LNCaP cells with ERG- or ETV1-silenced VCaP or LNCaP cells, respectively, in hormone deprived and stimulated conditions. VCAP and LNCaP cells, 24 hr after ERG or ETV1 RNA interference, respectively, were grown in hormone-depleted conditions for 2 days, and then in the presence of EtOH (vehicle) or 10nM DHT for 16hr. Total RNA was extracted from three biological replicates. This was used to hybridize to Affymetrix expression arrays using the HG-U133 Plus 2.0 platform.

2013-03-01 | E-GEOD-39354 | biostudies-arrayexpress

Expression profiling of human prostate non-tumorigenic RWPE-1 cells after overexpressing ERG and ETV1, and ERG and ETV1 silencing on prostate cancer cells LNCaP and VCaP, respectively

2013-03-01 | GSE39353 | GEO

ETV1 and ERG genome binding/occupancy profiling by genome tiling array

Project description:Chromosomal rearrangements involving ETS factors, ERG and ETV1, occur frequently in prostate cancer. How these factors contribute to tumorigenesis and whether they play similar in vivo roles remain elusive. We show that ERG and ETV1 control a common transcriptional network but in an opposing fashion. In mice with ERG or ETV1 targeted to the endogenous Tmprss2 locus, either factors cooperated with Pten-loss, leading to localized cancer, but only ETV1 supported development of advanced adenocarcinoma, likely through enhancement of androgen receptor signaling and steroid biosynthesis. Indeed, ETV1 expression promotes autonomous testosterone production, which may contribute to tumor progression to castration-resistant prostate cancer. Patient data confirmed association of ETV1 expression with aggressive disease. We conclude that despite many shared targets, ERG and ETV1 contribute differently to prostate tumor biology. Hence, prostate cancers with these fusions should be considered as distinct subtypes for patient stratification and therapy. Genomic targets of ERG and ETV1 transcription factors were identified by antibody-mediated and biotin-mediated ChIP-chip in human VCaP and LNCaP cells, respectively.

2013-03-01 | E-GEOD-39357 | biostudies-arrayexpress

Expression profiling of human prostate non-tumorigenic RWPE-1 cells after overexpressing ERG and ETV1, and ERG and ETV1 silencing on prostate cancer cells LNCaP and VCaP, respectively

Project description:Chromosomal rearrangements involving ETS factors, ERG and ETV1, occur frequently in prostate cancer. We here examine human prostate non-tumorigenic RWPE-1 cells with ERG- or ETV1-expressing stable RWPE-1 cell. RWPE-1 stable cell clones overexpressing ERG and ETV1 were grown under normal conditions. Total RNA was extracted from three biological replicates. This was used to hybridize to Affymetrix expression arrays using the HG-U133 Plus 2.0 platform.

2013-03-01 | E-GEOD-39353 | biostudies-arrayexpress

ETV1 and ERG genome binding/occupancy profiling by genome tiling array

2013-03-01 | GSE39357 | GEO

The effect of ERG overexpression and ERG knockdown by shRNA in RWPE1 and VCAP cells, respectively

Project description:The goal of this project was to analyze the global gene expression profiles of RWPE1 and VCAP cells following transfection of GFP, GFP-ERG at 48 and 72hrs time points and stable ERG shRNA, scramble shRNA, respectively. RWPE1 cells were transfected with GFP or GFP-ERG. VCAP cells were transfected with ERG lenti-shRNA or scramble shRNA. Transfections were performed in duplicate. Total cellular RNA was isolated with Trizol and quality analysed by the bioanalyser kit.

2010-08-25 | E-GEOD-16671 | biostudies-arrayexpress

Effect of ETV1 knockdown on genome wide AR binding in LNCaP Cells

Project description:Translocation of ETS transcription factors including ERG and ETV1 occur in half of all prostate cancers. LNCaP cells harbor an ETV1 translocation. We performed ChIP-Seq analysis to determine the role of ETV1 on AR binding. The localization of enhancers were determined by H3K4me1 ChIP-Seq.

2013-06-13 | GSE47120 | GEO

Effect of ETV1 knockdown on genome wide AR binding in LNCaP Cells

2013-06-13 | E-GEOD-47120 | biostudies-arrayexpress

ERG is a critical regulator of Wnt/LEF1 signaling in prostate cancer

Project description:Chromosomal translocations juxtaposing the androgen-responsive TMPRSS2 promoter with the ETS-family transcription factor ERG result in aberrant ERG up-regulation in approximately 50% of prostate cancers. Studies to date have demonstrated important roles of ERG in inducing oncogenic properties of prostate cancer. Its molecular mechanisms of action, however, are yet to be fully understood. To address these questions, we generated engineered LNCaP cells with ERG overexpression followed by LEF1 knockdown as well as control cell lines. To further investigate the role of LEF1 in ERG fusion positive samples, we also knockdown ERG in VCaP cell line. We performed microarray analysis on LNCaP cells with ERG overexpression followed by LEF1 knockdown using siRNA. We also knockdown endogenous ERG in fusion-positive cell line VCaP.

2013-05-29 | E-GEOD-47423 | biostudies-arrayexpress

Gene expression profile of ETV1 knockdown in LNCaP prostate cancer cells

Project description:Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after infection and gene expression profiling was performed. Among genes downregulated were many well characterized androgen regulated genes. LNCaP cells logarthmically growing in full serum was infected with three different shRNA lentiviruses. Three days after infection

2013-05-10 | E-GEOD-46329 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data