Gene expression analysis after selective expression of tissue factor isoforms
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
PROVIDER: GSE41872 | GEO | 2012/10/27
SECONDARY ACCESSION(S): PRJNA178362
REPOSITORIES: GEO
Similar Datasets
Project description:Analysis of TF isoform-induced breast cancer cell transformation at gene expression level. The hypothesis tested in the present study was that expression of TF isoforms upregulate genes involved in proliferation and transformation, while downregulating genes involved in cell cycle arrest and apoptosis. Results provide important information on the cellular response to TF expression with respect to pro-oncogenic programs . Total RNA obtained from an MCF-7-based cell model (2A3-3) expressing full length tissue factor (2A3-3-flTF) or alternatvively spliced tissue factor (2A3-3-asTF) compared to cells expressing an empty vector control (2A3-3-pcDNA).
2012-10-27 | E-GEOD-41872 | biostudies-arrayexpress
Project description:ChIP-seq was performed using Drosophila Kc167 cells using antibodies against the two isoforms of Fs(1)h, the Brd4 homologue. Differences in binding patterns between the two isoforms are described. We examined the differences in Fs(1)h isoform binding across the genome and describe the short isoform to be correlated with transcription at enhancers and promoters. The long isoform is found predominately at insulator binding sites where multiple insulators are bound.
2012-11-15 | E-GEOD-42086 | biostudies-arrayexpress
Project description:Alternative splicing generates differing RNA isoforms that govern phenotypic complexity of eukaryotes. Its malfunction underlies many diseases, including cancer and cardiovascular diseases. Comparative analysis of RNA isoforms at the genome-wide scale has been difficult. Here, we established an experimental and computational pipeline that accurately quantifies transcript isoforms in their entire length from cDNA sequences with a full-length isoform detection accuracy of 97.6%. We generated a searchable, quantitative human transcriptome annotation with 31,025 known and 5,740 novel transcript isoforms (http://steinmetzlab.embl.de/iBrowser/). By analyzing the isoforms in the presence of RNA Binding Motif Protein 20 (RBM20) mutations associated with aggressive dilated cardiomyopathy (DCM), we identified 121 differentially expressed transcript isoforms in 107 cardiac genes. By establishing an isoform-differential expression test, our approach revealed that 11 of these genes displayed no detectable change in overall RNA expression. However, significant differences in the expression of specific isoforms in these genes was observed. These isoform specific effects demonstrate the need of analyzing RNA isoform expression levels rather than total gene expression levels.
2021-06-16 | E-MTAB-7334 | biostudies-arrayexpress
Project description:Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5′ and 3′ untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5′ untranslated regions exert robust translational control between cell lines, while 3′ untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels.
2016-01-11 | GSE69352 | GEO
Project description:Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5â?² and 3â?² untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5â?² untranslated regions exert robust translational control between cell lines, while 3â?² untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels. Total cytoplasmic and eight polysomal fractions of RNA were purified from HEK 293T cells in biological duplicate. Ribosomal RNA was depleted using Ribo-Zero (Human/Mouse/Rat; Epicenter) and libraries were prepared using the TruSeq RNA v2 kit (RS-122-2001; Illumina) skipping the polyA selection step. Reads are paired-end 75bp and sequencing adapters are GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (read1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read2).
2016-01-11 | E-GEOD-69352 | biostudies-arrayexpress
Project description:NudCD1, also known as CML66 or OVA66, is a 583 amino acids protein initially identified as overexpressed in patients with chronic myelogenous leukemia. The mRNA of NudCD1 is expressed in heart and testis of normal tissues, and is overexpressed in several cancers. Previous studies have shown that the expression level of the protein correlates with tumoral phenotype, possibly interacting upstream of the Insulin Growth Factor - 1 Receptor (IGF-1R). The gene encoding the NudCD1 protein consists of 12 exons that can be alternative spliced, leading to the expression of three different isoforms. These isoforms possess a common region of 492 amino acids in their C-terminus region and have an isoform specific N-terminus. To determine the distinct function of each isoforms, we have localised the isoforms within the cells using immunofluorescence microscopy and used a quantitative proteomics approach (SILAC) to identify specific protein interaction partners for each isoforms. Location studies showed a different cellular location for the different isoforms, with the first isoform being nuclear, while the other two isoforms have distinct cytoplasmic and nuclear location. We found that the different NudCD1 isoforms have unique interacting partners, with the first isoform binding to a putative RNA helicase named DHX15 possibly involved in mRNA splicing.
2017-12-06 | PXD005493 | Pride
Project description:Glucocorticoids regulate diverse physiologic processes and synthetic derivatives of these natural hormones are widely used in the treatment of inflammatory diseases. However, chronic administration often triggers insensitivity and serious side effects including osteoporosis. The underlying mechanisms regulating these side effects are not completely understood. We report here that human osteosarcoma U-2 OS bone cells lacking the glucocorticoid receptor (GR) are resistant to glucocorticoid killing whereas the expression of wild-type GR activates an apoptotic program. Furthermore, we show that the translationally generated GR isoforms from a single GR gene have distinct abilities to induce apoptosis in these cells. Only cells expressing selective GR isoforms underwent apoptosis upon dexamethasone treatment and microarray analysis demonstrated that GR isoforms selectively stimulated the expression of pro-apoptotic enzymes such as caspase 6 and granzyme A. Chromatin immunoprecipitation assays further revealed that GR isoform-dependent induction of pro-apoptotic genes is likely due to selective coregulator recruitment and chromatin modification. Together, these findings provide evidence for a direct apoptotic effect of glucocorticoids on bone cells via selective GR isoforms and delineate multiple molecular components involved in tissue-specific glucocorticoid-induced bone cell apoptosis. Keywords: time course, isoform comparison
2007-12-20 | GSE6711 | GEO
Project description:Analysis of coagulation factor FVII-induced breast cancer cell transformation at gene expression level. The hypothesis tested in the present study was that expression of FVII upregulates genes involved in epithelial-to-mesenchymal transition and transformation. Results provide important information on the cellular response to tumor FVII expression with respect to pro-oncogenic programs .
2018-09-18 | GSE120047 | GEO
Project description:The SALL2 transcription factor (TF), an evolutionarily conserved gene through vertebrates, is involved in normal development and neuronal differentiation and considered as a tumor suppressor in certain human cancers. Several transcriptional targets of SALL2 are identified, these include the p21CDKN1A and p16INK4A cyclin-dependent kinase inhibitors, and the PMAIP1 and Bax pro-apoptotic genes, among others in various cell types. The human and mouse SALL2 gene loci contain two promoters, each one controlling the expression of a different protein isoform (namely E1 and E1A). However, several improvements on the human genome assembly and gene annotation through next-generation sequencing technologies over time reveal correction and annotation of additional isoforms, obscuring dissection of SALL2 isoform-specific transcriptional targets. We here integrated current data of normal/tumor gene expression databases along with ChIP-seq binding profiles to analyze SALL2 isoforms expression distribution and infer isoform-specific SALL2 targets. We found that the canonical SALL2 isoform (E1) is one of the lowest expressed, while isoform E1A is highly predominant across cell types. To dissect SALL2 isoform-specific targets, we analyzed publicly available ChIP-seq data from glioblastoma multiforme (GBM) and in-house ChIP-seq datasets performed in SALL2 wild-type and isoform E1A knockout HEK293 cells. Another available ChIP-seq data in HEK293 cells (ENCODE Consortium Phase III) overexpressing a non-canonical SALL2 isoform (herein named short_E1A) was analyzed but not included in the final analysis because we demonstrated that short_E1A is mostly localized in the cytoplasm, making impractical to dissect its direct transcriptional targets in this cell model. Regardless of cell type, our analysis reveals a highly conserved network of brain-specific TFs (i.e., SALL3, POU3F2, and NPAS3) and PODXL as a gene that is likely regulated by SALL2 across cell types. Our data integration identified a conserved molecular network in which SALL2 regulates target genes and encourages validation of publicly available ChIP-seq datasets for assessing transcriptional targets of a specific gene/isoform. Financial support: This work was supported by Fondecyt Regular Grants #1151031, #1191172 to Roxana Pincheira Fondecyt Regular Grant #120 to Ariel Castro, Postdoctorate Fondecyt Grant #3160129 and Fondecyt de Iniciacion # 1119028 to Matias I.Hepp.
2020-08-28 | GSE145940 | GEO
Project description:We report the identification of genomic regions bound by RBP2 isoforms and define the functional categories that these regions represent. RBP2 modifies methylated lysine residues on histone tails. We found that RBP2 large isoform containing the recognition module for histone H3K4me3 and RBP2 small isoform lacking this module bind to to different regions in the human genome. Importantly, isoform-specific regions and overlapping regions belong to genes with different molecular functions. For example, chromatin binding and transcription factor binding functions can be ascribed to gene targets of RBP2 small isoform but not of RBP2 large isoform. By comparing gene sets generated for all isoforms and RBP2 large isoform, we can define if the small isoform is specifically recruited to genomic regions dispaying certain signatures, such as transcription start sites, CpG-rich regions, transcriptional activity and transcription factor binding.
2015-03-23 | GSE28323 | GEO