Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Expression data from preimplantation mouse embryos

ABSTRACT: Landmark events occur in a coordinated manner during preimplantation development of the mammalian embryo, yet the regulatory network that orchestrates these events remains largely unknown. We delineated the regulons of Oct4, Sall4, and Nanog using morpholino (MO)-mediated gene knockdowns followed by microarray analysis of pooled embryos.

ORGANISM(S): Mus musculus

PROVIDER: GSE42135 | GEO | 2012/11/09

SECONDARY ACCESSION(S): PRJNA179194

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Expression data from preimplantation mouse embryos

Project description:Landmark events occur in a coordinated manner during preimplantation development of the mammalian embryo, yet the regulatory network that orchestrates these events remains largely unknown. We delineated the regulons of Oct4, Sall4, and Nanog using morpholino (MO)-mediated gene knockdowns followed by microarray analysis of pooled embryos. 1-cell fertilized mouse embryos were injected with a morpholino and were collected at either 20 hours or at 44 hours after microinjection.

2012-11-09 | E-GEOD-42135 | biostudies-arrayexpress

Mouse preimplantation imprinting

Project description:Mouse preimplantation imprinting

| PRJNA638349 | ENA

Mass spectrometry of clinically-discarded preimplantation embryos

Project description:Clinically-discarded oocytes and preimplantation embryos at various stages were collected to perform proteome analysis.

2025-05-26 | PXD042633 | Pride

Identification of differentially-expressed genes between FoxH1 morpholino and control in zebrafish embryos.

Project description:The Forkhead Box H1 (FoxH1) protein is a co-transcription factor recruited by phosphorylated Smad2 downstream of several TGFbetas, including Nodal-related proteins. We have reassessed the function of zebrafish FoxH1 using antisense morpholino oligonucleotides (MOs) ( 5’ TGCTTTGTCATGCTGATGTAGTGGG 3’) as compared with a control morpholino (MO) with no specific target (5’ TAGTTAAGCCTAGCTCTCATAAACT 3’). Probing FoxH1 morphant RNA by microarray, we identified a cohort of five keratin genes – cyt1, cyt2, krt4, krt8 and krt18 - that are normally transcribed in the embryo’s enveloping layer (EVL) and which have significantly reduced expression in FoxH1-depleted embryos. Keywords: 40% epiboly-stage embryos, injected with either 8 ng of a 25mer morpholino (MO) with no specific target or 8 ng of a 25mer MO with reverse complementary to the 5’ untranslated region of the zebrafish foxH1 gene.

2007-07-30 | GSE8076 | GEO

Transcriptome analysis of the Zebrafish model of Diamond-Blackfan Anemia from RPS19 deficiency via p53-dependent and -independent pathways

Project description:To determine the effect on the whole transcriptome of RPS19 morpholino and to identify the function of p53 in RPS19-deficient embryos, we analyzed the genome-wide transcript profiles of control morpholino (control), RPS19 morpholino knockdown (RPS19 MO), and RPS19 and p53 morpholino knockdown simultaneously (RPS19+p53 MO) using the Illumina Hi-seq 2000 Genome Analyzer platform with paired-end 100 base-pair tags to a depth of 35-60 million reads. We found that genes enriched in the functions of hematological systems and nervous system development and that skeletal and muscular disorders had significant differential expression in RPS19 MO embryos compared with controls. Co-inhibition of p53 partially alleviates the abnormalities for RPS19-deficient embryos. However, the hematopoietic genes, which were down-regulated significantly in RPS19 MO embryos, were not completely recovered by the co-inhibition of p53. Furthermore, we identified the genome-wide p53-dependent and -independent genes and pathways. These results indicate that not only p53 family members but also several other factors have important impacts on RPS19-deficient embryos. The detection of potential pathogenic genes and pathways provides us a new paradigm for research on DBA, which is a systematic and complex hereditary disease.

2013-10-09 | GSE45699 | GEO

Mouse preimplantation imprinting [WGBS]

Project description:Mouse preimplantation imprinting [WGBS]

| PRJNA638354 | ENA

Knockdown of slc2a10/glut10 in zebrafish embryos vs. controls

Project description:A zebrafish model of arterial tortuosity syndrome (ATS) was generated by knocking down the slc2a10/glut10 gene using antisense morpholino oligonucleotides (MO). Control morpholino treated embryos were used as controls. The samples were collected for gene expression profiling at 48 hours post fertilization. Experimental details and analyzed data are available in Willaert et al. Human Molecular Genetics 2011; doi: 10.1093/hmg/ddr555 Two-condition experiment, slc2a10 MO (7.5ng) treatment vs control MO (5ng) treatment. Biological replicates: 3 slc2a10 MO replicates, compared to a pooled sample of 3 control MO replicates with dye swap.

2011-12-17 | E-GEOD-34508 | biostudies-arrayexpress

Comparative proteomic landscapes provide insights into mammalian preimplantation development and failure

Project description:Understanding mammalian preimplantation development, particularly in humans, at the proteomic level remains limited. Here, we applied our comprehensive solution of ultrasensitive proteomic technology to measure the proteomic profiles of oocytes and early embryos and identified nearly 8,000 proteins in humans and over 6,300 proteins in mice. We observed distinct proteomic dynamics before and around zygotic genome activation (ZGA) between the two species. Integrative analysis with translatomic data revealed extensive divergence between translation activation and protein accumulation. Multi-omic analysis indicated that ZGA transcripts often contribute to protein accumulation in blastocysts. Using mouse embryos, we identified several transcriptional regulators critical for early development, thereby linking ZGA to the first lineage specification. Furthermore, single-embryo proteomics of poor-quality embryos from over 100 patient couples provided insights into preimplantation development failure. Our study may contribute to reshaping the framework of mammalian preimplantation development and opening avenues for addressing human infertility.

2025-02-05 | PXD054371 | Pride

Knockdown of slc2a10/glut10 in zebrafish embryos vs. controls

2011-12-17 | GSE34508 | GEO

Intraindividual Genetic Variation in Human Fetuses with a Preimplantation Origin

Project description:Intraindividual copy number variations (CNVs) happen post-zygotically, however their origin is largely unknown. They might appear either through aging or may resist following the common chromosome instability at the preimplantation stage. To uncover a part of this question we investigated fetal mosaicism and its origin. According to distribution pattern of frequent CNVs in derivatives of different germ layers, their origin is early development including preimplantation, whereas CNVs with low frequency occur in later stages. Both fetuses share CNVs, some in the same tissues and some other in different tissues. Functional analysis showed that altered genes were involved in embryonic development pathways. Each organ inherits CNVs with an unpredictable pattern due to extensive cell mixing/migration in embryonic development. Since we have found frequent intraindividual reciprocal CNVs as events with preimplantation origin in both fetuses, mosaic embryo transfer should be performed with caution because it may increase susceptibility to develop early/late onset diseases with genetic component even though recent reports seems to encourage IVF clinics for mosaic embryo transfer.

2020-09-25 | GSE104314 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data