Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Expression data comparing dp53R-shSCR and dp53R-shARF mouse embryonic fibroblasts

ABSTRACT: Mouse embryonic fibroblasts deficient for p53 and expressing mutant RasV12 were infected with lentiviral constructs carrying short hairpin RNAs targeting ARF or a scrambled control. Four days post infection, cells were harvested for microarray analysis.

ORGANISM(S): Mus musculus

PROVIDER: GSE48315 | GEO | 2013/06/27

SECONDARY ACCESSION(S): PRJNA209699

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Similar Datasets

Expression data comparing dp53R-shSCR and dp53R-shARF mouse embryonic fibroblasts

Project description:Mouse embryonic fibroblasts deficient for p53 and expressing mutant RasV12 were infected with lentiviral constructs carrying short hairpin RNAs targeting ARF or a scrambled control. Four days post infection, cells were harvested for microarray analysis. 6 Total samples were analyzed. Arrays were downloaded from Washington University bioinformatics web site and processed in Affymetrix Expression Console (Affymetrix, Version) using RMA (Robust Multi-chip Average)algorithm. Only core probesets were used for the analysis. Control probesets as well as those interrogating probesets that are absent across all 12 arrays were filtered out. We considered those probesets as 'Present' while their signal intensity exceeded Mean (negative control signal intensity) +2 X Standard deviations (negative control signal intensity).Hierarchical cluster map was plotted using Partek Genomic suite to visualize the sample quality and differential expression analysis was performed using Significant Analysis of Microarrays (SAM) and list of differentially expressed genes were generated.

2013-06-27 | E-GEOD-48315 | biostudies-arrayexpress

Gene expression profile of doxycycline inducible shHNF4G hairpins in 22RV1 prostate cancer cells

Project description:To determine genes regulated by HNF4G, we performed doxycycline induced shRNA mediated knockdown of HNF4G using two lentiviral constructs as well as a scrambled shRNA in duplicate. Two pLKO.1 constructs against HNF4G (HNF4Gsh1: TRCN0000019243, targeting CACCAGCATCTCTCCAAACAA in coding DNA sequence (CDS); and HNF4Gsh2: TRCN0000420190, targeting GATGAGCTGGTTAGACCATTTC in CDS) were purchased from Sigma Aldrich MISSION® shRNA Plasmid DNA and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after doxycycline treatment and gene expression profiling was performed.

2017-11-01 | GSE85242 | GEO

Gene expression profile of ETV1 knockdown in LNCaP prostate cancer cells

Project description:Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after infection and gene expression profiling was performed. Among genes downregulated were many well characterized androgen regulated genes.

2013-05-10 | GSE46329 | GEO

Gene expression profile of 22RV1 prostate cancer cells upon SPINK1 knockdown

Project description:Serine Peptidase Inhibitor, Kazal type 1 (SPINK1) overexpression represents the second-largest prostate cancer (PCa) subtype associated with increased risk of biochemical recurrence and poor prognosis. To determine the pathways regulated by SPINK1 in 22RV1 prostate cancer cells, we performed shRNA mediated knockdown of SPINK1 using lentiviral constructs. Scrambled shRNA was used as a control. pGIPZ constructs against SPINK1 (shSPINK1-1, shSPINK1-2, shSPINK1-3) and control shScrambled construct were purchased from Dharmacon.

2019-12-16 | GSE124345 | GEO

UGT2B17 knock down in chronic lymphocytic leukemia cell line MEC-1

Project description:Comparison of gene expression after stable shRNA induced knock down of UGT2B17 and scrambled shRNA in the cell line model MEC-1. Transfection was performed using lentiviral particles, RNA was harvested after culture for 2 weeks. Results provide insight into functional UGT2B17 involvement in CLL cells.

2015-05-01 | GSE38367 | GEO

Gene expression profile of ETV1 knockdown in LNCaP prostate cancer cells

2013-05-10 | E-GEOD-46329 | biostudies-arrayexpress

Barcoded mRNA-seq of murine brown preadipocytes (IBA) upon transcriptomic perturbation

Project description:Loss of function assays were performed in differentiating IBAs using short hairpin RNAs (shRNAs) against a set of candidate transcription factors: NFIA, DBP, HOXA4, ZFP467, SOX18, ELF3, YBX2 and PPARa. Gene expression profiles of the perturbed and non perturbed (controls including non transduced cells, cells transduced with scrambled and GFP constructs) transcriptomes were measured at Day 6 of differentiation using a novel multiplex, bulk mRNA-seq barcoding method which employs a 3' sequencing approach. This method allowed the measurement of the deviation of the perturbed transcriptome from the non-perturbed transcriptome.

2017-09-21 | E-MTAB-5161 | biostudies-arrayexpress

Comparison of primary MEF vs HRasV12 + Twist transformed MEF

Project description:MEF cells were sequentially infected with H-RasV12 and Twist (Twist1 or Twist2) expression retroviral constructs. Gene expression profiles of the resulting transformed cell lines were compared to the gene expression profile of primary MEF cells

2008-07-11 | GSE11756 | GEO

Quantitative proteomics of CELF1-silenced human melanoma cell lines

Project description:CELF1 was silenced in two human melanoma cell lines (SKMEL-103 and UACC-62, indicated as 9M and 17M, respectively) using short hairpin RNA (tag 114). As control scrambled non targeting shControl transduced cell were used (tag 115).

2017-12-21 | PXD003112 | Pride

UGT2B17 knock down in chronic lymphocytic leukemia cell line MEC-1

2015-05-01 | E-GEOD-38367 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data