Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Differentially expressed genes associated with hepatic steatosis in zebrafish

ABSTRACT: Expression microarray of livers from adult zebrafish: control, overfed, and ahcy+/- Comparison of expression from livers obtained from ahcy+/+, overfed ahcy+/+, ahcy+/- control and ahcy+/- overfed.

ORGANISM(S): Danio rerio

PROVIDER: GSE48806 | GEO | 2013/10/01

SECONDARY ACCESSION(S): PRJNA211818

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Similar Datasets

Differentially expressed genes associated with hepatic steatosis in zebrafish

Project description:Expression microarray of livers from adult zebrafish: control, overfed, and ahcy+/- Comparison of expression from livers obtained from ahcy+/+, overfed ahcy+/+, ahcy+/- control and ahcy+/- overfed. Adult zebrafish, ahcy+/+ and +/-, were given a regular diet or were overfed for a month. Livers were removed, RNA isolated, and expression microarray was performed.

2013-10-01 | E-GEOD-48806 | biostudies-arrayexpress

Differentially expressed genes after inhibition of methylation

2013-07-11 | GSE48804 | GEO

Differentially expressed genes after inhibition of methylation

Project description:Expression microarray of livers from 4 dpf control zebrafish larvae, larvae treated with azacytidine, and ahcy mutant larvae Comparison of expression from livers obtained from ahcy+/+ treated with vehicle, ahcy+/+ treated with azacytidine, and ahcy-/- treated with vehicle. We treated larvae starting at 2 dpf with 1 mM azacytidine or vehicle control. Livers were removed at 4 dpf, RNA isolated, and double amplified.

2013-07-11 | E-GEOD-48804 | biostudies-arrayexpress

Differentially expressed genes in zebrafish vascular development

2008-08-22 | GSE12516 | GEO

Differentially expressed genes in zebrafish vascular development

Project description:The goal of this experiment was to identify using tissue specific transgenic zebrafish (Fli:EGFP), genes of interest important for embryonic vascular development. Keywords: time course, GFP cell isolation, zebrafish The experiment contained 6 samples. A18, A24 = total RNA isolated from 18 and 24 hpf zebrafish embryo; B2, C and D2=RNA isolated from GFP positive cells sorted at 18, 24 and 28 hpf respectively from Tg(Fli1:EGFP) embryos; E2 = RNA isolated from GFP positive cells sorted at 18 hpf from Tg(Flk:GRCFP) embryos.

2010-05-22 | E-GEOD-12516 | biostudies-arrayexpress

Effect of obesity on liver immune response to inflammatory stimuli in a diet-obesity model of zebrafish (Danio rerio)

Project description:We used a Diet-Induced-Obesity approach using the zebrafish (Danio rerio) based on overfeeding to analyze the liver transcriptomic modulation in the disease and to determine how the obesity affects the immune response against an acute inflammatory stimulus as the lipopolysacharide (LPS). Overfed zebrafish were obese and showed signs of steatosis in their liver. Furthermore, the gene modulation profile resembled to that observed in humans. After the inflammatory stimulus, there was a clear differential immune response in normal and overfed fish. In normal fish, the response to LPS reported a typical host defensive reaction comparable to the one occurring in stimulated mammals whereas there was not any significantly modulated gene when comparing the expression of liver from LPS-stimulated with non-stimulated obese zebrafish.

2015-03-23 | GSE56478 | GEO

Differentially expressed genes in Mettl3-deficient livers compared to control livers

Project description:Differentially expressed genes in Mettl3-deficient livers compared to control livers

| PRJNA812058 | ENA

Metabolic and transcriptional adaptations improve physical performance of zebrafish

Project description:Background: Obesity is a worldwide public health problem with increasing prevalence and affects 80% of diabetes mellitus type 2 cases. Zebrafish (Danio rerio) are an established model organism for studying obesity and diabetes including diabetic microvascular complications. We aimed to determine whether physical activity is an appropriate tool to examine training effects in zebrafish and to analyse metabolic and transcriptional processes in trained zebrafish. Methods: A 2- and 8-weeks experimental training phase protocol with adult zebrafish in a swim tunnel system was established. We examined zebrafish basic characteristics before and after training such as body weight, body length and maximum speed and considered overfeeding as an additional parameter in the 8-weeks training protocol. Ultimately, the effects of training and overfeeding on blood glucose, muscle core metabolism and liver gene expression using RNA-Seq were investigated. Results: Zebrafish maximum speed was correlated with body length and was significantly increased after 2 weeks of training. Maximum swim speed further increased after 8 weeks of training in both the normalfed and the overfed groups, but training was found not to be sufficient in preventing weight gain in overfed fish. Metabolome and transcriptome profiling in trained fish exhibited increased blood glucose levels in the short-term and upregulated energy supply pathways in the long-term. Conclusion: Swim training is a valuable tool to study effects of physical activity in zebrafish, which is accompanied by metabolic and transcriptional adaptations.

2021-12-06 | GSE183023 | GEO

Differential hepatic gene expression in zebrafish (Danio rerio) exposed to the fungicide chlorothalonil reveals estrogenicity

Project description:Chlorothalonil (2,4,5,6-tetrachloroisophthalonitrile) is a broad spectrum fungicide used extensively in agricultural crops . The aim of this study is to analyse the effects of Chorothalonil on the gene expression profiles in zebrafish (Danio rerio), exposed to two concentrations of the fungicide in the water. Nominal concentrations were 1) Low 0.007mg/l (environmentally relevent) and 2) High 0.035mg/ml . A commercial third generation microarray for Danio rerio (Agielnt V3, 4x44k) was used to identify patterns of gene expression in male livers during a 96h toxicological assay. Replicates: Six control, five low and four high concentrations ; 15 samples examined. Expression profiles of male livers compared. Two concentrations of the fungicide chlorothalonil were compared.

2015-06-17 | E-GEOD-67600 | biostudies-arrayexpress

Identification of differentially-expressed genes between FoxH1 morpholino and control in zebrafish embryos.

Project description:The Forkhead Box H1 (FoxH1) protein is a co-transcription factor recruited by phosphorylated Smad2 downstream of several TGFbetas, including Nodal-related proteins. We have reassessed the function of zebrafish FoxH1 using antisense morpholino oligonucleotides (MOs) ( 5’ TGCTTTGTCATGCTGATGTAGTGGG 3’) as compared with a control morpholino (MO) with no specific target (5’ TAGTTAAGCCTAGCTCTCATAAACT 3’). Probing FoxH1 morphant RNA by microarray, we identified a cohort of five keratin genes – cyt1, cyt2, krt4, krt8 and krt18 - that are normally transcribed in the embryo’s enveloping layer (EVL) and which have significantly reduced expression in FoxH1-depleted embryos. Keywords: 40% epiboly-stage embryos, injected with either 8 ng of a 25mer morpholino (MO) with no specific target or 8 ng of a 25mer MO with reverse complementary to the 5’ untranslated region of the zebrafish foxH1 gene.

2007-07-30 | GSE8076 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data