Abundance of isoforms of adenovirus 5-encoded miRNAs.
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
PROVIDER: GSE50576 | GEO | 2014/12/18
SECONDARY ACCESSION(S): PRJNA217975
REPOSITORIES: GEO
Similar Datasets
Project description:Human adenovirus 5 encodes a small set of miRNAs, which are generated by DICER-mediated processing of 2 larger precursors, the so-called virus-associated RNAs I and II. To identify targets of one of the major miRNA isoforms derived from virus-associated RNAI (mivaRNAI-137), we isolated Argonaute complexes of mivaRNAI-137-transfected cells and analyzed co-purifying RNAs by microarray analysis. RNAs enriched in Argonaute complexes of mivaRNAI-137-transfected cells compared to cells transfected with a control siRNA were identified and subjected to further validation. RNAs specifically associated with Argonaute-containining complexes of adenovirus 5-infected cells were identified as well.
2014-12-23 | GSE50541 | GEO
Project description:Alternative Cleavage and Polyadenylation (APA) plays a crucial role in the regulation of gene expression across eukaryotes. Although APA is extensively studied, its regulation within cellular compartments and its physiological impact remains largely enigmatic. Here, we employed a rigorous subcellular fractionation approach to compare APA profiles of cytoplasmic and nuclear RNA fractions from human cell lines. This comparison allowed us to extract APA isoforms that are subjected to differential regulation and provided us with a platform to interrogate the molecular regulatory pathways that shape the APA profiles in the subcellular locations. Subsequently, we depleted these cells of Dicer to compromise the miRNA biogenesis pathway to isolate the differentially regulated APA events that were regulated by miRNA.
2015-09-29 | GSE68671 | GEO
Project description:Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5â?² and 3â?² untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5â?² untranslated regions exert robust translational control between cell lines, while 3â?² untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels. Total cytoplasmic and eight polysomal fractions of RNA were purified from HEK 293T cells in biological duplicate. Ribosomal RNA was depleted using Ribo-Zero (Human/Mouse/Rat; Epicenter) and libraries were prepared using the TruSeq RNA v2 kit (RS-122-2001; Illumina) skipping the polyA selection step. Reads are paired-end 75bp and sequencing adapters are GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (read1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read2).
2016-01-11 | E-GEOD-69352 | biostudies-arrayexpress
Project description:Abundance and localization of human UBE3A isoforms
| PRJNA512845 | ENA
Project description:mRNA and microRNA expression was examined in global cellular fractions and in RNA-induced silencing complex (RISC)-immunoprecipitated cell fractions in cultured primary human astrocytes (ScienCell) and in cultured human U-87 MG astrocytoma cells (ATCC). ABSTRACT: Background: GW/P bodies are cytoplasmic ribonucleoprotein-rich foci that are involved in microRNA (miRNA)-mediated messenger RNA (mRNA) silencing and degradation. These mRNA regulatory functions within GW/P bodies are mediated by GW182 and its binding partner hAgo2 when bound to miRNA within the RNA-induced silencing complex (RISC). Although miRNAs and mRNAs are known to be localized to RISC in a variety of cells, to date no published study has examined the profile of specific miRNA and mRNA targeted to the RISC. Methodology/Principle Findings: In this study, RISC mRNA and miRNA components were profiled by microarray analysis of human U-87 astrocytoma cells and primary human astrocytes with total RNA extracted from the RISC as well as the global cellular fractions. The novel findings of this study were fourfold: (1) miRNAs are highly enriched in primary astrocyte RISC compared to U-87 astrocytoma RISC, (2) astrocytoma cells and primary astrocytes each contain unique RISC miRNA profiles as compared to their respective cellular miRNA profiles, (3) miR-195, 10b, 29b, 19b, 34a and 455-3p were upregulated and miR-181b was downregulated in U-87 astrocytoma RISC as compared to primary astrocyte RISC, and (4) RISC contain mostly downregulated mRNAs in primary astrocytes and U-87 astrocytoma cells. Conclusions/Significance: We show that in U-87 astrocytoma cells, miR-34a and miR-195 were upregulated in RISC suggesting an oncogenic role for these miRNAs. Three miR34a-targeted mRNAs and two miR-195-targeted mRNAs were downregulated. One miR-195-targeted mRNA was upregulated. Biological pathway analysis of RISC mRNA components suggests that the RISC plays a pivotal role in cancer, inflammatory disease, immunological disease, the cell cycle, cellular movement and numerous cell signaling pathways. This study points to the importance of the RISC and ultimately GW/P body composition and function and in miRNA and mRNA deregulation in astrocytoma cells and possibly for other brain tumors.
2011-05-26 | GSE21514 | GEO
Project description:unidentified adenovirus Genome sequencing and assembly
| PRJNA399039 | ENA