Dataset Information

Epstein Barr Virus Nuclear Antigen 3C binds to BATF/IRF4/SPI1 sites and represses CDKN2A by recruiting Sin3A

ABSTRACT: We report the application of ChIP Seq to study the Epstein Barr Virus Nuclear Antigen 3C, an essential transcriptional regulator involved in the transformation of Resting B Lymphocytes to the immortalized Lymphoblast Cell Lines

ORGANISM(S): Homo sapiens

PROVIDER: GSE52632 | GEO | 2013/12/22

SECONDARY ACCESSION(S): PRJNA229507

REPOSITORIES: GEO

ACCESS DATA

Similar Datasets

Project description:CCAT1-L is a highly expressed long noncoding RNA located in the colorectal cancer specific super enhance region about 500 kb upstream of MYC gene. Knockdown of CCAT1-L significantly down-regulated interaction frequency between CCAT1 and MYC locus and repress MYC expression, suggesting a long-range chromatin interaction between CCAT1-L and MYC locus maintained by CCAT1-L underlie the MYC regulation. To further validate this hypothesis, multiplexed 3C sequencing (3C-seq) was employed to evaluate chromatin interaction strength between CCAT1-L and MYC locus in CCAT1-L knockdown and scramble knockdown (Scr) HT29 cells. The 3C-Seq design and data analysis were performed according to Stadhouders et al, Nat Protoc. 2013, 8:509-524. A series of bait sequences accommodating different locus around CCAT1-L and MYC were selected. Through integrating with specific sample barcodes, bait-specific primer sets were designed to construct relevant 3C-seq libraries in CCAT1-L knockdown and scramble knockdown (Scr) HT29 samples. All of the 3C sample libraries from different treatment, including CCAT1-L knockdown and scramble knockdown (Scr), were then pooled together for high-throughput sequencing. Two technical 3C-seq were performed (CCAT1_myc_3C_1.txt.gz and CCAT1_myc_3C_2.txt.gz) and then combined together to get enough reads for further analysis. 3C-seq reads from different samples were divided according to sample barcodes (CCAT1-L knockdown: ATGTCA; Scr: GCCAAT) and different bait sequences, and then mapped to human reference genome to assess chromatin interaction strength between CCAT1-L and MYC locus in different treatments. In our study, one representative bait-specific sequencing data (CTTCTACTGATTGGCCCTAAACACTTTTCCAAAGCTT) was select to generate bedgraph files and upload to UCSC for visualization to show the chromatin interaction between CCAT1-L and Myc locus in CCAT1-L knockdown (CCAT1-L_knockdown_out.bedgraph) and scramble knockdown (Scr_out.bedgraph) samples.

Project description:Epstein Barr virus (EBV) nuclear antigen 3C (EBNA3C) is an essential transcription factor for initiating and maintaining human B lymphocyte transformation to lymphoblastoid cell lines (LCLs). To comprehensively identify EBNA3C regulated cell genes in LCLs, oligonucleotide arrays were used to compare RNA abundances in 3 different LCLs transformed by an EBV that conditionally expresses EBNA3C. Cell RNA levels were assessed in actively growing LCLs, under non-permissive or permissive conditions or under non-permissive conditions after transcomplementation with wild type EBNA3C. A two-way ANOVA model with covariates including the 3 different clone effects and the 3 EBNA3C expression levels, identified 550 EBNA3C regulated genes, with False Discovery Rate <0.01 and >1.5 fold change. A seeded Bayesian network analysis of the 80 most significantly EBNA3C regulated genes that changed >1.5 fold, positioned RAC1, LYN and TNF upstream of other EBNA3C regulated genes. Further, Gene Set Enrichment Assay (GSEA) identified EBNA3C regulated genes to be enriched for MAP kinase signaling, cytokine-cytokine receptor interactions, JAK-STAT signaling, and cell adhesion molecule effects, implicating these pathways in LCL growth or survival. Moreover, 106 EBNA3C regulated genes could be placed in protein interaction networks. Since CXCL12 and CXCR4 signaling are implicated in LCL growth and were EBNA3C up-regulated, up-regulation of CXCL12 was validated by qRT-PCR and effects on induced LCL migration were confirmed. EBNA3C regulated genes significantly overlapped with EBNA2 and EBNA3A regulated genes, consistent with a central role for RBP/CSL in these effects. RNAs from three different Lymphoblastoid Cell Lines(LCLs) expressing conditional EBNA3C grown under permissive or non-permissive conditions for 7 days; the same LCLs transcompletemented with EBNA3C expressed in trans at full wild-type level were used to identify EBNA3C regualted cellular genes. Total cell RNAs were hybrdized to Affymetrix U-133 Plus 2.0 microarrays. A two way ANOVA model was developed with covariates including the 3 different clone effects and the 3 EBNA3C expression levels and identified 550 EBNA3C regulated genes.

Dataset Information

Epstein Barr Virus Nuclear Antigen 3C binds to BATF/IRF4/SPI1 sites and represses CDKN2A by recruiting Sin3A

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure