Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

A Highly Sensitive and Specific System for Large-scale Gene Expression Profiling

ABSTRACT: Gene expression profiling of very few or even single cells is of particular interest in many applications. However, detection of a large number of mRNA sequences from a small number of cells is limited by the sensitivity of available methods. High-throughput multiplex reverse transcription followed by PCR amplification (RT-PCR) has much to offer to these studies due to its inherent sensitivity, efficiency and cost-effectiveness. A multiplex RT-PCR based high-throughput gene profiling system is described in this communication. With this system >1000 different mRNA species can be amplified in a single tube to a detectable amount. By using specially designed PCR primers, the long-standing low specificity problem associated with high-throughput gene expression profiling has been solved. Amplified sequences are then resolved by microarray with probes that only hybridize to sequences amplified from mRNA. The method is so sensitive that mRNA in single cells can be reliably detected. Differentially expressed genes identified with the high-throughput approach in the breast cancer cell line, MCF-7, and its drug resistant variant, MCF-7/AdrR, could be validated by a different method. The approach may greatly facilitate the analysis of combinatorial expression of known genes in any cells in many important applications with a limited amount of RNA. Keywords: drug resistence

ORGANISM(S): Homo sapiens

PROVIDER: GSE5920 | GEO | 2007/06/01

SECONDARY ACCESSION(S): PRJNA97363

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Similar Datasets

Novel TCR sequencing and cloning methods for sensitive and quantitative interrogation of repertoires and rapid isolation of tumor-reactive TCRs

Project description:We report on SEQTR, a novel high-throughput approach to analyze human and mouse repertoires that is more sensitive, reproducible and accurate as compared to commonly-used multiplex PCR and 5'RACE assays.

2023-05-22 | GSE225984 | GEO

Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology

Project description:To determine the extent to which the major small RNA pathways functions across the Arabidopsis thaliana genome, small RNA populations from several tissues of wild-type (wt) and mutant plants were amplified by RT-PCR and sequenced using high-throughput 454 sequencing technology. Keywords: small RNAs, high-throughput sequencing

2007-02-01 | GSE6682 | GEO

Project description:High-throughput accuracy for multiplex amplicon sequencing

| PRJNA245467 | ENA

NanoString analysis of a rat liver mRNA panel following TCDD treatment

Project description:Profiling of mRNA abundances with high-throughput platforms such as microarrays and RNA-Seq has become an important tool in both basic and biomedical research. However these platforms remain prone to systematic errors, and have challenges in clinical and industrial application. As a result it is standard practice to validate a subset of key results using alternate technologies. Similarly, clinical and industrial applications typically involve transitions from high-throughput discovery platform to medium-throughput validation ones. These medium-throughput validation platforms have high technical reproducibility and reduced sample input needs, and low sensitivity to sample-quality (e.g. for processing FFPE specimens). Unfortunately, while medium-throughput platforms have proliferated, there are no comprehensive comparisons of them. Here we fill that gap by comparing two key medium-throughput platforms – NanoString’s nCounter Analysis System and ABI’s OpenArray System – to gold-standard quantitative real-time RT-PCR.

2013-12-31 | GSE43251 | GEO

Project description:High sensitivity detection of SARS-CoV-2 using multiplex PCR and a multiplex-PCR-based metagenomic method

| PRJNA614546 | ENA

GSC RT-PCR amplification of 10 cells (SP & CD8 T cells), single SP cell and single-SP-cell equivalent

Project description:GSM48315-GSM48332: Ten cells from C57Bl/6 male mouse bone marrow (SP or CD8 T cells) were sorted into individual wells of 96-well plates. The mRNA of these cells was amplified by the global single cell RT-PCR method and biotinylated targets were generated after optimal digestion with DNAse I. GSM48333-GSM48344: Single SP cell from C57Bl/6 male mouse bone marrow were sorted into individual wells of 96-well plates. The mRNA of these single cells was amplified by the global single cell RT-PCR method and biotinylated targets were generated after optimal digestion with DNAse I. GSM48345-GSM48349: Forty bone marrow SP cells from C57Bl/6 male mouse bone marrow, Sca-1 positive and Gr-1 negative, gated on the tip of the SP tail, were sorted into 160 microliters of lysis buffer (40 times the amount used for single cells). 4-microliter aliquots (containing the mRNA equivalent to one single cell) were dispensed into individual wells of 96-well plates. The mRNA contained in each aliquot was amplified by the global single cell RT-PCR method and biotinylated targets were generated after optimal digestion with DNAse I. Detection of the microarray hybridization signals was done according to the standard Affymetrix protocol (antibody amplified). Keywords = HSC Keywords = stem cell Keywords = SP Keywords = side population Keywords = CD8 Keywords = lymphocytes Keywords = global single cell RT-PCR Keywords = GSC RT-PCR Keywords: parallel sample

2006-01-02 | GSE2534 | GEO

Multiplex genome-editing in Arabidopsis thaliana using Mb3Cas12a

Project description:The use of CRISPR/Cas proteins for the creation of multiplex genome-engineering represents an important avenue for crop improvement, and further improvements for creation of knock-in plant lines via CRISPR-based technologies may enable the high-throughput creation of designer alleles. To circumvent limitations of the commonly used CRISPR/Cas9 system for multiplex genome-engineering, we explored the use of Moraxella bovoculi 3 Cas12a (Mb3Cas12a) for multiplex genome-editing in Arabidopsis thaliana. We identified optimized promoter sequences for driving expression of single transcript multiplex crRNA arrays in A. thaliana, resulting in stable germline transmission of Mb3Cas12a-edited alleles at multiple target sites. By utilizing this system, we demonstrate single-transcript multiplexed genome-engineering using of up to 13 crRNA targets. We further show high target specificity of Mb3Cas12a-based genome-editing via whole-genome sequencing. Taken together, our method provides a simplified platform for efficient multiplex-genome-engineering in plant-based systems.

2021-09-15 | GSE162875 | GEO

A unified strategy to clone modified/unmodified small RNAs and mRNAs for high throughput sequencing

Project description:The high-throughput sequencing has become a standard tool for analyzing gene expression. Usually a cDNA/DNA library is constructed with 5' and 3' linkers and then sequenced. Unlike mRNA, small RNA often contains modifications including 5' cap or triphosphate and 3' methylation, affecting the linker addition during cloning processes. Small RNA is expressed at much lower levels than mRNA, making it more difficult to clone small RNA using a small amount of total RNA. Here we have developed a new strategy to clone modified/unmodified small RNA in an all-liquid-based reaction in a single PCR tube using as little as 20 ng total RNA. The 7-hour cloning process only needs ~1 hour labor time. Moreover, this method can be used to clone mRNA, simplifying the need to prepare two cloning systems for small RNA and mRNA. Since the linkers used are derived from the Illumina Truseq linkers for DNA cloning, the PCR primers based on the linker sequences can be used to obtain amplicons derived from small RNA/mRNA/DNA. Not only is our method more convenient for cloning modified RNA than available methods, but it is also more sensitive, accurate and versatile. Moreover, the all-liquid-based reaction can be performed in an automated manner.

2020-01-24 | GSE129664 | GEO

Interactions of CAF1-NOT complex components from Trypanosoma brucei

Project description:Our trypanosome yeast two-hybrid prey library was made by random shotgun genomic cloning. NOT2, NOT10, NOT11 and CAF40 were used as baits to screen the library by mating. Diploid progeny were subjected to selection, resulting in between 100 and 800 surviving colonies, from which inserts were amplified and subjected to high-throughput sequencing. This is a Multiplex Library identified using the following primers: >CZ5468-Not1 CTCTACCCATCGAGCTCGAGCTACGTCAACG >CZ5472-ZC3H38 TCGGGACATCGAGCTCGAGCTACGTCAACG >CZ5473-Tb927_7_2780 GAATGAATCGAGCTCGAGCTACGTCAACG >CZ5474-Not11 TGACATCCATCGAGCTCGAGCTACGTCAACG. Yeast 2-hybrid Interactions for NOT10 (Tb927.10.8720), NOT11 (Tb927.8.1960), XAC1 (Tb927.7.2780) and ZC3H38 (Tb927.10.12800)

2022-01-14 | E-MTAB-4946 | biostudies-arrayexpress

Improvements to the HITS-CLIP protocol eliminate widespread mispriming artifacts.

Project description:High-throughput sequencing of RNA isolated by crosslinking immunoprecipitation (HITS-CLIP) allows for high resolution, genome-wide mapping of RNA-binding proteins. We found that substantial mispriming during reverse transcription results in the overrepresentation of sequences complementary to the primer used for reverse transcription. Up to 45% of peaks in publicly available HITS-CLIP libraries are attributable to this artifact, and the majority of libraries have detectable levels of mispriming. We also found that standard techniques for validating miRNA-target interactions fail to differentiate between artifactual peaks and physiologically relevant peaks. Here, we present a modification to the HITS-CLIP protocol that effectively eliminates this artifact. Argonaute HITS-CLIP on the MCF-7 breast cancer cell line treated with 17Î²-estradiol for 0, 6 or 24 hours using a nested reverse transcriptions pimer and protected or unprotected reverse PCR primers for library amplification.

2016-02-19 | E-GEOD-78059 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data