Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Expression data from Control or ShSuz12 rat Intestinal epithelial cells IEC-6

ABSTRACT: Polycomb-group proteins form multimeric protein complexes involved in transcriptional silencing. The Polycomb Repressive complex 2 (PRC2) contains the Suppressor of Zeste-12 protein (Suz12) and the histone methyltransferase Enhancer of Zeste protein-2 (Ezh2). This complex, catalyzing the di- and tri-methylation of histone H3 lysine 27, is essential for embryonic development and stem cell renewal. However, the role of Polycomb-group protein complexes in the control of the intestinal epithelial cell (IEC) phenotype is not known. We investigated the impact of Suz 12 depletion on gene expression in IEC-6 cells.

ORGANISM(S): Rattus norvegicus

PROVIDER: GSE60003 | GEO | 2014/08/02

SECONDARY ACCESSION(S): PRJNA257268

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Similar Datasets

Expression data from Control or ShSuz12 rat Intestinal epithelial cells IEC-6

Project description:Polycomb-group proteins form multimeric protein complexes involved in transcriptional silencing. The Polycomb Repressive complex 2 (PRC2) contains the Suppressor of Zeste-12 protein (Suz12) and the histone methyltransferase Enhancer of Zeste protein-2 (Ezh2). This complex, catalyzing the di- and tri-methylation of histone H3 lysine 27, is essential for embryonic development and stem cell renewal. However, the role of Polycomb-group protein complexes in the control of the intestinal epithelial cell (IEC) phenotype is not known. We investigated the impact of Suz 12 depletion on gene expression in IEC-6 cells. Multiple shRNA lentiviral constructs were tested in IEC-6 cells for their ability to down-regulate Suz12 expression (MISSION shRNA lentiviral transduction particles, SigmaM-bM-^@M-^SAldrich Canada, Oakville, ON). Forty percent confluent cells were infected in medium supplemented with 4 mg/ml polybrene (SigmaM-bM-^@M-^SAldrich Canada) for 6 h. Two days after infection, cell populations were selected with 2 mg/ml puromycin (SigmaM-bM-^@M-^SAldrich Canada). The clone TRCN0000038728 was selected: the shRNA against Suz12 (GCTGACAATCAAATGAATCAT) is conserved in rat (accession number FM084383), murine (accession number NM_199196) and human (accession number NM_015355.2) Suz12 sequences. Efficiency of infection was estimated at 25%. Control or ShSuz12 IEC-6 cell total RNAs were isolated with the Rneasy kit (Qiagen, Mississauga, ON, Canada), according to the manufacturerM-bM-^@M-^Ys instructions. RNA samples from three independent experiments were used for microarray analysis.

2014-08-02 | E-GEOD-60003 | biostudies-arrayexpress

Chromatin maps of human ASXL1, FOXK1 and O-GlcNAc

Project description:Polycomb group (PcG) proteins are major determinants of gene silencing and epigenetic memory in higher eukaryotes. Acting in multimeric protein complexes, these factors control structure and function of chromatin. We used a robust affinity purification mass spectrometry (AP-MS) approach to systematically map the PcG protein interactome in a single human cell line. Importantly, we uncovered the topology map of the human PR-DUB de-ubiquitination complexes, which comprise the O-linked N-acetylglucosamine transferase OGT1 and a number of transcription factors. Here we provide genome-wide chromatin maps of identified PR-DUB1 subunits ASXL1, FOXK1 and the OGT1 catalyzed modification O-GlcNAc based on ChIP-seq.

2016-09-08 | GSE51673 | GEO

Expression profile of WT and IKKb(EE)IEC epithelial cells (IEC)

Project description:To investigate NF-kB-driven gene expression in IEC, we performed microarray analysis from enterocytes of mice that express a constitutively active form of IKKb in intestinal epithelial cells Total RNA was prepared from enterocytes obtained from small intestines of IKKb(EE)IEC and WT littermates. Two biological replicates were performed for each experimental condition.

2011-06-09 | E-GEOD-29701 | biostudies-arrayexpress

Chromatin maps of human ASXL1, FOXK1 and O-GlcNAc

2016-09-08 | E-GEOD-51673 | biostudies-arrayexpress

Expression data from jejunum IEC deleted for both HDAC1 and HDAC2

Project description:Both HDAC1 and HDAC2 are epigenetic erasers that drive specific and redundant gene expression patterns, in part by removing acetyl groups on histones. Deletion of these Hdac in intestinal epithelial cell (IEC) in vivo alters intestinal homeostasis, dependent on the Hdac deleted and the level of expression of both. To determine the intrinsic specific IEC function of HDAC1 and HDAC2, we have performed transcriptomic and quantitative proteomic approaches on IEC-deficient for Hdac1 and Hdac2. We have defined changes in both mRNA and protein expression patterns affecting IEC differentiation. We have identified IEC Hdac1- and Hdac2-dependent common as well as specific pathways and biological processes. These findings uncover unrecognized similarities and differences between normal IEC and HDAC1/2 deleted jejunum IEC.

2020-12-31 | GSE158522 | GEO

Polycomb Protein Ezh1 Promotes RNA Polymerase II Elongation

Project description:Polycomb group (PcG) proteins initiate the formation of repressed chromatin domains and regulate developmental gene expression. A mammalian PcG protein, Enhancer of Zeste homolog 2 (Ezh2), triggers transcriptional repression by catalyzing the addition of methyl groups onto lysine-27 of histone H3 (H3K27me2/3)1. This action facilitates the binding of other PcG proteins to histone H3 and compaction of chromatin. Interestingly, there exists a paralog of Ezh2, termed Ezh1, whose primary function remains unclear. Here, we provide evidence for genome-wide association of Ezh1 with active epigenetic marks, RNA polymerase II (PolII) and mRNA production. Ezh1 depletion reduced global PolII occupancy within gene bodies and resulted in delayed transcriptional activation during differentiation of skeletal muscle cells. Conversely, ectopic expression of wild-type Ezh1 led to premature gene activation and rescued PolII-elongation defects in Ezh1-depleted cells. Collectively, these findings reveal an unanticipated role of a PcG protein in promoting mRNA transcription. Examination of 3 different histone modifications, 3 modified forms of RNA polymerase II, Ezh1, Ezh2 and mRNA levels in a skeletal muscle cells at various developmental stages.

2011-11-23 | E-GEOD-25549 | biostudies-arrayexpress

CBX7 is a tumour suppressor that inhibits bladder cancer

Project description:The Polycomb Group Proteins (PcG) are epigenetic regulatory complexes, dysregulation of which has been associated with multiple biological processes, including maintenance of cell identity, differentiation, proliferation, and cancer progression.PcGs form two multiprotein complexes, Polycomb repressive complex 1 (PRC1) and PRC2(1).The PRC2 protein complex mainly consists of Early embryonic deficient (EED), Suppressor of Zeste (SUZ12) and Enhancer of Zeste (EZH), which can catalyzes the trimethylation of histone H3 lysine 27 (H3K27me3), thereby leaving a transcriptionally repressive mark on the chromatin . Such alterations are recognized and read by canonical PRC1 which is composed of CBX (polycomb), PCGF (polycomb group factor), HPH (human polyhomeotic homolog), and the E3-ligase protein (RING) that catalyzes the monoubiquitination of histone H2A on lysine 119 (H2AK119ub1). The H3K27me3 mark is identified by and binds to the chromodomain within the CBX protein in PRC1, thereby ubiquitinating H2AK119 via the RING proteins. The interaction of PRC2 and PRC1 in chromatin contributes to chromatin compaction and transcriptional silencing of target genes.There are five chromobox proteins in humans, CBX2, 4, 6, 7 and 8. Increasing evidence supports essential roles of CBX proteins in tumorigenesis. Remarkably, CBX proteins have shown an opposite function in distinct cancer types in tumor development. For example, CBX7 is overexpressed in ovarian and prostate cancer , implying its oncogenic role in these tumor types. In contrast, CBX7 functions as a tumor suppressor and loss of CBX7 has been associated with increasing the malignancy grade in bladder, breast, pancreatic, glioma, and colon carcinomas (3 4 5 6 7), but its tumor suppression mechanism is unclear.

2021-06-15 | GSE158244 | GEO

Chromatin immunoprecipitation of mouse polycomb group (PcG) proteins in embryonic stem cells

Project description:Polycomb group (PcG) proteins are highly conserved from flies to mammals and many of these factors have essential roles in early embryonic development. PcG proteins comprise two multimeric complexes, the Polycomb Repressive complexes 1 and 2 (PRC1 and 2), which have been shown to repress transcription through epigenetic modification of chromatin structure. To gain insight into the role of Polycomb in early development, we have identified PRC1 and PRC2 target genes in mouse embryonic stem (ES) cells using genome-scale location analysis. We found that PRC2 occupies many genes that encode key regulators of development including those encoding transcription factors and components of signaling pathways. These genes are repressed and contain nucleosomes methylated at lysine 27 on histone H3. The majority of PRC2 bound and methylated target genes are co-occupied by PRC1 indicating that these complexes function at a similar set of genes in ES cells. Lack of PRC1 or PRC2 subunits in ES cells results in derepression of target genes and loss of pluripotency. These results provide insight into how PcG proteins contribute to the maintenance of stem cell identity.

2006-05-09 | E-WMIT-12 | biostudies-arrayexpress

Expression data from colon samples from FADD IEC-KO (intestinal epithelial cell-knock out) and CASP8 IEC-KO mice in combination with different genetic mutations (Zbp1 -/-, Mlkl -/-, Ripk3 IEC-KO)

Project description:FADD-IEC KO and CASP8 IEC-KO mice spontaneously develop chronic colitis charcterized by inflammatory gene expression. We characterized the role of MLKL, RIPK3, ZBP1, in the upregulation of inlflammatory genes in these mice. We used microarray to study the effect of MLKL, RIPK3 and ZBP1 on the gene expression profile in FADD IEC-KO and/or CASP8 IEC-KO mice and detect effects on specific inflammatory genes.

2020-05-01 | GSE137281 | GEO

Expression data from ileum samples from FADD IEC-KO (intestinal epithelial cell-knock out) and CASP8 IEC-KO mice in combination with different genetic mutations (Zbp1 -/-, Mlkl -/-, Ripk3 IEC-KO)

Project description:FADD-IEC KO and CASP8 IEC-KO mice spontaneously develop chronic ileitis charcterized by inflammatory gene expression. We characterized the role of MLKL, RIPK3, ZBP1, in the upregulation of inlflammatory genes in these mice. We used microarray to study the effect of MLKL, RIPK3 and ZBP1 on the gene expression profile in FADD IEC-KO and/or CASP8 IEC-KO mice and detect effects on specific inflammatory genes.

2020-05-01 | GSE137280 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data