Single-cell analyses of regulatory network perturbations using enhancer-targeting TALEs suggest novel roles for PU.1 during haematopoietic specification
Ontology highlight
ABSTRACT:
ORGANISM(S): Mus musculus
PROVIDER: GSE61189 | GEO | 2014/11/05
SECONDARY ACCESSION(S): PRJNA260492
REPOSITORIES: GEO
Similar Datasets
Project description:The aim of this study was to determine the genomic binding sites of an HA-tagged Transcription Activator-Like Effector (TALE) fused to a VP64 domain with a DNA binding domain designed to bind the sequence GGGCGCTTCCTGTTTTCTCA (found in the PU.1-14kb enhancer element in mouse and human genome), termed HA-T-VP64-PU.1-14, in the 416B mouse myeloid progenitor cell line. Inducible T-VP64-PU.1-14 transgene contained within the piggyBac vector was stably integrated into 416B cells by transfection along with a constituteively expressed rtTA plasmid (pCAG-rtTA-piggyBac) and a piggyBac transposase. 416Bs carrying stably integrated transgenes were FACS sorted based on their ability to expressed the transgene and expanded before HA-T-VP64-PU.1-14 expression was induced for 48 hours by addition of dox before cells were fixed with 1% formaldehyde for 10 mins. Chromatin was isolated, sonicated for 7 mins (30 sec on, 30 sec off), and an anti-HA antibody used to pull down the HA-T-VP64-PU.1-14 after a pre-clearing step. Chromatin was washed, de-crosslinked, amplified, size selected by gel purification and sequenced. As a control, untransfected 416B cells were similarly ChIP'd.
2014-11-05 | E-GEOD-61189 | biostudies-arrayexpress
Project description: Not available
| S-EPMC4197694 | biostudies-literature
Project description:To guarantee blood supply throughout adult life hematopoietic stem cells (HSCs) need to carefully balance between self-renewing cell divisions and quiescence. Identification of genes controlling HSC self-renewal is of utmost importance given that HSCs are the only stem cells with broad clinical applications. Transcription factor PU.1 is one of the major regulators of myeloid and lymphoid development. Recent reports suggest that PU.1 mediates its functions via gradual expression level changes rather than binary on/off states. So far, this has not been considered in any study of HSCs and thus, PU.1’s role in HSC function has remained largely unclear. Here we demonstrate using hypomorphic mice with an engineered disruption of an autoregulatory feedback loop that decreased PU.1 levels resulted in loss of key HSC functions, all of which could be fully rescued by restoration of proper PU.1 levels via a human PU.1 transgene. Mechanistically, we found excessive HSC cell divisions and altered expression of cell cycle regulators whose promoter regions were bound by PU.1 in normal HSCs. Adequate PU.1 levels were maintained by a mechanism of direct autoregulation restricted to HSCs through a physical interaction of a -14kb enhancer with the proximal promoter. Our findings identify PU.1 as novel regulator controling the switch between cell division and quiescence in order to prevent exhaustion of HSCs. Given that even moderate level changes greatly impact stem cell function, our data suggest important therapeutic implications for leukemic patients with reduced PU.1 levels. Moreover, we provide first proof, that autoregulation of a transcription factor, PU.1, has a crucial function in vivo. We anticipate that our concept of how autoregulation forms an active chromosomal conformation will impact future research on transcription factor networks regulating stem cell fate. HSCs of Pu.1 knock-in (PU.1ki/ki) mice were used for RNA extraction and hybridization on Affymetrix microarrays. We compared these microarray samples with the corresponding wild type.
2011-12-01 | E-GEOD-33031 | biostudies-arrayexpress
Project description:To guarantee blood supply throughout adult life hematopoietic stem cells (HSCs) need to carefully balance between self-renewing cell divisions and quiescence. Identification of genes controlling HSC self-renewal is of utmost importance given that HSCs are the only stem cells with broad clinical applications. Transcription factor PU.1 is one of the major regulators of myeloid and lymphoid development. Recent reports suggest that PU.1 mediates its functions via gradual expression level changes rather than binary on/off states. So far, this has not been considered in any study of HSCs and thus, PU.1’s role in HSC function has remained largely unclear. Here we demonstrate using hypomorphic mice with an engineered disruption of an autoregulatory feedback loop that decreased PU.1 levels resulted in loss of key HSC functions, all of which could be fully rescued by restoration of proper PU.1 levels via a human PU.1 transgene. Mechanistically, we found excessive HSC cell divisions and altered expression of cell cycle regulators whose promoter regions were bound by PU.1 in normal HSCs. Adequate PU.1 levels were maintained by a mechanism of direct autoregulation restricted to HSCs through a physical interaction of a -14kb enhancer with the proximal promoter. Our findings identify PU.1 as novel regulator controling the switch between cell division and quiescence in order to prevent exhaustion of HSCs. Given that even moderate level changes greatly impact stem cell function, our data suggest important therapeutic implications for leukemic patients with reduced PU.1 levels. Moreover, we provide first proof, that autoregulation of a transcription factor, PU.1, has a crucial function in vivo. We anticipate that our concept of how autoregulation forms an active chromosomal conformation will impact future research on transcription factor networks regulating stem cell fate.
2011-12-01 | GSE33031 | GEO
Project description:PU.1 is a prototype master transcription factor (TF) of hematopoietic cell differentiation with diverse roles in different lineages. Analysis of its genome-wide binding pattern across PU.1 expressing cell types revealed manifold cell type-specific binding patterns. They are not consistent with the epigenetic and chromatin constraints to PU.1 binding observed in vitro, suggesting that PU.1 requires auxiliary factors to access DNA in vivo. Using a model of transient mRNA expression we show that PU.1 induction leads to the extensive remodeling of chromatin, redistribution of partner transcription factors and rapid initiation of a myeloid gene expression program in heterologous cell types. By probing PU.1 mutants for defects in chromatin access and screening for PU.1 proximal proteins in vivo, we found that its N-terminal acidic domain was required for the recruitment of SWI/SNF remodeling complexes, de novo chromatin access and stable binding as well as the redistribution of partner TFs.
2019-11-20 | PXD013167 | Pride
Project description:The Ets family transcription factor PU.1 is essential for the development and maintenance of several hematopoietic lineages. In the thymus, PU.1 is expressed only in the early ETP/DN1, DN2a and DN2b stages of development. While PU.1 deletion in multipotent precursors leads to a complete block in T-cell development its function in the intrathymic stages in which it is expressed remains undetermined. The goal of this expression profiling study was to determine if PU.1 regulates the expression of T-lineage genes during the early stages of development. To do this, we generated the PU.1-Eng construct which expresses a fusion protein containing the DNA binding ETS domain of PU.1 (aas 159-260) fused to the obligate repressor domain (aas 1-298) of the Drosophila engrailed protein. The PU.1-ETS construct only expresses the ETS domain of PU.1 (aas 159-260) and serves as a control. Fetal liver precursors were isolated from e14.5 embryos and co-cultured with OP9-DL1 cells in the presence of IL-7 and Flt3L (5 ng/ml each) for 4 days to obtain FLDN1, DN2a and DN2b cells. These were infected with vector only, PU.1-ETS and the PU.1-Eng constructs and DN2 cells were sorted after 20 hours of infection. Total RNA was isolated from these cells and polyA+ fraction was used to prepare libraries for high throughput sequencing. Libraries prepared from 2 independent sets of samples were subjected to non-strand specific single-end sequencing. Two sets of samples generated from fetal liver precursor derived DN2 cells expressing PU.1-ETS and PU.1-Eng constructs were used for expression profiling. The LZRS retroviral vector, without any insert, was used to generate the vector control dataset.
2015-04-08 | E-GEOD-65344 | biostudies-arrayexpress
Project description:The majority of sequence-specific transcription factors bind genomic DNA only at a fraction of their potential binding sites and the ‘rules’ for binding or not-binding are only partially understood. Here, we studied the binding properties of the myeloid and B-cell specific transcription factor PU.1 in-vivo and in-vitro to unveil basic features of occupied vs. non-occupied consensus sites. In addition to published PU.1 ChIP-seq data we mapped CTCF binding sites in monocytes and macrophages to determine chromatin domain boundaries and performed MCIp-seq in monocytes to reveal DNA methylation patterns across the genome. ChIP-seq of CTCF in human monocytes and human monocyte-derived macrophages as well as MCIp-seq in human monocytes
2013-05-15 | E-GEOD-43098 | biostudies-arrayexpress
Project description:ChIP-Sequencing on Shox2-HA E12.5 and E13.5 Limb and Palate, as well as Pbx on E12.5 limb . Abstract: Vertebrate appendage patterning is programmed by Hox-TALE factors-bound regulatory elements. However, it remains enigmatic which cell lineages are commissioned by Hox-TALE factors to generate regional specific pattern and whether other Hox-TALE co-factors exist. In this study, we investigated the transcriptional mechanisms controlled by the Shox2 transcriptional regulator in limb patterning. Harnessing an osteogenic lineage-specific Shox2 inactivation approach we show that despite widespread Shox2 expression in multiple cell lineages, lack of the stylopod observed upon Shox2 deficiency is a specific result of Shox2 loss of function in the osteogenic lineage. ChIP-Seq revealed robust interaction of Shox2 with cis-regulatory enhancers clustering around skeletogenic genes that are also bound by Hox-TALE factors, supporting a lineage autonomous function of Shox2 in osteogenic lineage fate determination and skeleton patterning. Pbx ChIP-Seq further allowed the genome-wide identification of cis-regulatory modules exhibiting co-occupancy of Pbx, Meis, and Shox2 transcriptional regulators. Integrative analysis of ChIP-Seq and RNA-Seq data and transgenic enhancer assays indicate that Shox2 patterns the stylopod as a repressor via interaction with enhancers active in the proximal limb mesenchyme and antagonizes the repressive function of TALE factors in osteogenesis. Shox2/TALE For ChIP-Seq, the list of libraries below, including controls, were generated [listed in the format of (antibody)-target-tissue-stage]: (α-HA)-Shox2-Limb-E12.5, (α-HA)-Shox2-Limb-E13.5, (α-HA)-Shox2-Palate-E12.5, (α-HA)-Shox2-Limb/Palate-E12.5, (α-Pbx)-Pbx-Limb-E12.5, Input (control), (α-HA)-Mixed Limb/Palate from Shox2+/+ mice-E12.5 (control). *The attached signal tracks(*.bigwig) were generated by âbdgcmp (MACS2) to filter out background signal(by filtering against the signal track obtained from (α-HA)-Mixed Limb/Palate from Shox2+/+ mice-E12.5 (control)) and subsequently convert to bigwig for analysis and visualization.
2016-07-05 | E-GEOD-81897 | biostudies-arrayexpress
Project description:The Ets family transcription factor PU.1 is essential for the development and maintenance of several hematopoietic lineages. In the thymus, PU.1 is expressed only in the early ETP/DN1, DN2a and DN2b stages of development. While PU.1 deletion in multipotent precursors leads to a complete block in T-cell development its function in the intrathymic stages in which it is expressed remains undetermined. The goal of this expression profiling study was to determine if PU.1 regulates the expression of T-lineage genes during the early stages of development. To do this, we generated the PU.1-Eng construct which expresses a fusion protein containing the DNA binding ETS domain of PU.1 (aas 159-260) fused to the obligate repressor domain (aas 1-298) of the Drosophila engrailed protein. The PU.1-ETS construct only expresses the ETS domain of PU.1 (aas 159-260) and serves as a control. Fetal liver precursors were isolated from e14.5 embryos and co-cultured with OP9-DL1 cells in the presence of IL-7 and Flt3L (5 ng/ml each) for 4 days to obtain FLDN1, DN2a and DN2b cells. These were infected with vector only, PU.1-ETS and the PU.1-Eng constructs and DN2 cells were sorted after 20 hours of infection. Total RNA was isolated from these cells and polyA+ fraction was used to prepare libraries for high throughput sequencing. Libraries prepared from 2 independent sets of samples were subjected to non-strand specific single-end sequencing.
2015-04-08 | GSE65344 | GEO