Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Loss of SOX2 expression induces cell migration via Vimentin up-regulation and serves as unfavourable risk factor for poor survival of head and neck squamous cell carcinoma patients

ABSTRACT: Transcriptional profiling of patient derived HNSCC (head and neck squamous cell carcinoma) cell line HNO223 comparing control cells transfected with shRNA against luciferase (shLuci) with cells transfected with two different shRNAs targeting SOX2. The goal was to determine the effects of SOX2 knockdown on global gene expression.

ORGANISM(S): Homo sapiens

PROVIDER: GSE61599 | GEO | 2014/09/23

SECONDARY ACCESSION(S): PRJNA261666

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Similar Datasets

Loss of SOX2 expression induces cell migration via Vimentin up-regulation and serves as unfavourable risk factor for poor survival of head and neck squamous cell carcinoma patients

Project description:Transcriptional profiling of patient derived HNSCC (head and neck squamous cell carcinoma) cell line HNO223 comparing control cells transfected with shRNA against luciferase (shLuci) with cells transfected with two different shRNAs targeting SOX2. The goal was to determine the effects of SOX2 knockdown on global gene expression. Total RNA was extracted from stably transfected HNSCC cells with shLuci (control) and two different SOX2 shRNAs (shSOX2#1 and shSOX2#2), comparing the control with each of the two SOX2 shRNAs (replicate1: shLuci vs. shSOX2#1 and replicate2: shLuci vs. shSOX2#2). The biological replicates were from two independent transfection experiments (transfection 1 and transfection 2). Gene expression profiling was performed using the Human GE 4x44K v2 Microarray according to manufacturer`s instructions (Agilent, Santa Clara, CA).

2014-09-23 | E-GEOD-61599 | biostudies-arrayexpress

Dual knockdown of Esrrb and Sox2 in mouse embryonic stem cells

2012-11-22 | GSE34170 | GEO

Dual knockdown of Esrrb and Sox2 in mouse embryonic stem cells

Project description:Esrrb, Sox2 or Esrrb and Sox2 were knocked down in mouse ES cells using shRNA plasmid pSUPER.puro containing shRNAs from the publications Feng et al., 2009 and Rodda et al., 2005. Knockdown was transfected into mouse ES cells using lipofectamine and then cells were selected for knockdown using puromycin. RNA was harvested after 2 days of knockdown. Esrrb and Sox2 were knocked down in mouse ES cells either individually or together, cells were selected with puromycin and RNA harvested and subjected to microarray after 2 days.

2012-11-22 | E-GEOD-34170 | biostudies-arrayexpress

Identification the Expression of Sox2 in Colorectal Cancer Tissues

Project description:Sox2 has been studied in several types of human solid tumors. The investigators found that Sox2 had higher expression level in colorectal cancer and metastatic tissues than normal tissues. So the investigators assumed that whether Sox2 plays an important role in the progression and migration of colon cancer.

| 2124687 | ecrin-mdr-crc

ysblcc sox2

Project description:ysblcc sox2

| PRJEB2061 | ENA

MUC1-C PROMOTES CHRONIC INFLAMMATION IN THE PROGRESSION OF HEAD AND NECK SQUAMOUS CELL CARCINOMAS

Project description:Mucin 1 (MUC1) is aberrantly expressed in adenocarcinomas of epithelial barrier tissues and contributes to their progression. Less is known about involvement of MUC1 in the pathogenesis of squamous cell carcinomas (SCCs). The present work demonstrates that the MUC1 gene is upregulated in advanced head and neck SCCs (HNSCCs) and, as determined by scRNA-seq analysis, is expressed in the malignant cell populations of HNSCC tumors. Studies of HNSCC cell lines demonstrate that the MUC1-C subunit regulates expression of (i) RIG-I and MDA5 pattern recognition receptors, (ii) STAT1 and interferon (IFN) regulatory factors, and (iii) downstream IFN-stimulated genes (ISGs). MUC1-C integrates STAT1 with induction of the ∆Np63 and SOX2 genes that are aberrantly expressed in HNSCCs. We also show that MUC1-C/STAT1 signaling activates the NFE2L2 gene and, in turn, MUC1-C binds directly to NRF2 in regulating redox balance. In extending these HNSCC cell dependencies, we demonstrate that MUC1-C is necessary for NOTCH3 expression, self-renewal capacity and tumorigenicity. These results indicate that MUC1-C is a common effector that integrates STAT1-mediated chronic inflammation with regulation of the ∆Np63, SOX2, NRF2 and NOTCH3 TFs. Our findings indicate that MUC1-C drives progression of the HNSCC CSC state and is a target for advanced HNSCC treatment.

2024-04-23 | GSE252287 | GEO

Loss of SOX2 expression induces cell motility via vimentin up-regulation and is an unfavorable risk factor for survival of head and neck squamous cell carcinoma.

Project description: Not available

| S-EPMC5528792 | biostudies-literature

Competitive binding of E3 ligases TRIM26 and WWP2 controls SOX2 in glioblastoma

Project description:The pluripotency transcription factor SOX2 is essential for the maintenance of glioblastoma stem cells (GSC), which drive tumor growth and treatment resistance.To understand how SOX2 is regulated in GSCs, we utilized a proteomic approach and identified the E3 ubiquitin ligase TRIM26 as a direct SOX2-interacting protein. Unexpectedly, we found TRIM26 depletion decreased SOX2 protein levels and increased SOX2 polyubiquitination in patient-derived GSCs, suggesting TRIM26 promotes SOX2 protein stability. Accordingly, TRIM26 knockdown reduced SOX2 transcriptional activity, self-renewal capacity, and in vivo tumorigenicity in multiple GSC lines. Mechanistically, we found TRIM26, via its C-terminal PRYSPRY domain, but independent of its RING domain, stabilizes SOX2 protein by directly inhibiting the interaction of SOX2 with WWP2, which we identify as a bona fide SOX2 E3 ligase in GSCs. Our work identifies E3 ligase competition as a critical mechanism of SOX2 regulation, with functional consequences for GSC identity and maintenance.

2021-11-04 | PXD028933 | Pride

RNA-seq of human glioblastoma cell lines with overexpression of SOX2, SFRP2

Project description:Glioblastomas type A cell line (U-2987) was transfected with pLEX-blast-V5-YFP (control), and pLEX-blast-V5-SFRP2 (SFRP2), and type B cell culture (U-2982, U-343 MG) were transfected with pLEX-blast-V5-YFP (control), and pLEX-blast-V5-SOX2 (SOX2). Then RNA-seq was performed and used to analyse their regulation in the gene expression level.

2021-06-01 | E-MTAB-7591 | biostudies-arrayexpress

Sox2 promotes malignancy in glioblastoma by regulating plasticity and astrocytic differentiation

Project description:Making use of a previously described isogenic cancer stem cells and serum differentiated cultures we show that Sox2 controls developmental stated specific programs in glioblastoma. Glioblastoma cells were cultured as control and with SOX2 knockdown to identify the scope of SOX2 interactions. The SOX2 knockdown were accomplished using two knockdown technologies. The knockdown cells were compared to controls, early passage, and scrambled controls. For Sox2 knockdown in low passage 10% FBS cells, the following oligonucleotides targeting human SOX2 coding sequence, or non-silencing control sequence, were cloned into BLOCK-iT Pol II miR RNAi expression vectors (Invitrogen), before cell transfection into GBM monolayer cells using Lipofectamine-2000 (Invitrogen): Sox2miRNA1R:5’CCTGTGCATGGGCTGTCTGCGCTGTCAGTCAGTGGCCAAAACAGCGCAGATGCAGCCCATGCAC Sox2miRNA1F:5’TGCTGTGCATGGGCTGCATCTGCGCTGTTTTGGCCACTGACTGACAGCGCAGACAGCC Sox2miRNA2R:5’CCTGAACCCATGGAGAAGAGCCAGTCAGTCAGTGGCCAAAACTGGCTCTTGGCTCCATGGGTTC Sox2miRNA2F:5’TGCTGAACCCATGGAGCCAAGAGCCAGTTTTGGCCACTGACTGACTGGCTCTTCTCCATGGGTT miRNAnegative:5’GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT Sox2 knockdown in neurospheres: GIPZ Lentiviral shRNAmir constructs targeting human Sox2 (clones V3LHS_404430 and V3LHS_404432) and non-silencing control (RHS4346) were obtained (Thermo Scientific Open Biosystems) and lentivirus were prepared according to the manufacturer’s instructions. Sox2 ectopic expression: Sox2 cDNA was subcloned from pCMV6-XL5-NM_002106.2 (Origene) into pcDNA 3.1 mammalian expression vector (Invitrogen), under control of constitutive CMV promoter. Plasmid DNA constructs were stably transfected into GBM monolayer cells using Lipofectamine-2000 (Invitrogen).

2014-07-22 | GSE51441 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data