Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Med1 facilitates transcriptional activation and dynamic long-range contacts at the IgH locus during class switch recombination.

ABSTRACT: Immunoglobulin class switch recombination (CSR) is initiated by the transcription-coupled recruitment of activation induced cytidine deaminase (AID) to immunoglobulin switch (S) regions. During CSR, the IgH locus undergoes dynamic three-dimensional structural changes in which promoters, enhancers and S regions are brought to close proximity. Nevertheless, little is known about the underlying mechanisms. Here we conditionally inactivated in B cells the Med1 subunit of mediator, a complex implicated in transcription initiation and long-range enhancer/promoter loop formation. We find that Med1-deficiency results in defective CSR, reduced acceptor switch region transcription and that this correlates with reduced long-range interactions between the acceptor switch regions and the Em enhancer, as determined by 4C-Seq. Our results implicate the mediator complex in the mechanism of CSR and are consistent with a model in which Med1 facilitates the transcriptional activation of switch regions and their long-range contacts with the IgH locus enhancers during CSR.

ORGANISM(S): Mus musculus

PROVIDER: GSE62969 | GEO | 2016/02/17

SECONDARY ACCESSION(S): PRJNA266315

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Similar Datasets

Med1 facilitates transcriptional activation and dynamic long-range contacts at the IgH locus during class switch recombination.

Project description:Immunoglobulin class switch recombination (CSR) is initiated by the transcription-coupled recruitment of activation induced cytidine deaminase (AID) to immunoglobulin switch (S) regions. During CSR, the IgH locus undergoes dynamic three-dimensional structural changes in which promoters, enhancers and S regions are brought to close proximity. Nevertheless, little is known about the underlying mechanisms. Here we conditionally inactivated in B cells the Med1 subunit of mediator, a complex implicated in transcription initiation and long-range enhancer/promoter loop formation. We find that Med1-deficiency results in defective CSR, reduced acceptor switch region transcription and that this correlates with reduced long-range interactions between the acceptor switch regions and the Em enhancer, as determined by 4C-Seq. Our results implicate the mediator complex in the mechanism of CSR and are consistent with a model in which Med1 facilitates the transcriptional activation of switch regions and their long-range contacts with the IgH locus enhancers during CSR. 4C-seq data in resting and activated WT and Med1 mutant B cells. 4C bait was designed in the Eu enhancer of the Igh locus on chromosome 12. Primer sequences: 5â TCTGTCCTAAAGGCTCTGAGA 3â and 5â GAACACAGAAGTATGTGTATGGA 3â.

2016-02-17 | E-GEOD-62969 | biostudies-arrayexpress

The superenhancer binding factor Med1 is broadly required for optimally expressing and hypermutating IgH genes as well as for terminating their expression through locus suicide recombination

Project description:Assembly, expression and maturation of the Immunoglobulin heavy (IgH) chain repertoire necessitates long-range 3D-interactions under regulation by the IgH locus Eµ and 3’ regulatory region (3’RR) super-enhancers. In progenitors, Eµ instrumentally supports VDJ recombination notably towards distal VH genes. In mature cells, the 3’RR first boosts the production of membrane-type IgH transcripts. It later attracts Activation-induced cytidine deaminase at three specific locations: VDJ genes undergoing somatic hypermutation (SHM), switch regions undergoing class switch recombination (CSR), and the 3’RR itself during locus suicide recombination (LSR). In plasma cells devoted to abundant Ig secretion, a late long-range effect is to promote high IgH transcription. The Mediator subunit Med1, which binds super-enhancers and has increased activity after phosphorylation by ERK, was previously attributed a role restricted to class-switched cells. We now show its broader impact on IgH expression, both by promoting recombination of distal VH genes in progenitors and by later supporting SHM. Med1-dependence also marks all long-range functions of the 3’RR, including not only intra- but also trans-chromosomal CSR, LSR, optimal BCR expression and the transcriptional boost featured by plasma cells. Altogether, Med1 appears as a major and specific actor of all the long-range tasks effected by the IgH locus super-enhancers beyond transcription.

2022-10-20 | GSE136845 | GEO

Genome-wide localization of Smc1, Smc3 and CTCF in mouse B cells.

Project description:Immunoglobulin class switch recombination (CSR) is initiated by the transcription-coupled recruitment of activation induced cytidine deaminase (AID) to switch regions and by the subsequent generation and resolution of dsDNA breaks (DSBs). During, CSR the IgH locus undergoes dynamic three-dimensional structural changes in which promoters, enhancers and switch regions are brought to close proximity. Nevertheless, little is known about the underlying mechanisms. Here we show that during CSR, AID associates with subunits of cohesin, a complex previously implicated in DNA repair and in the formation of DNA loops between enhancers and promoters. By ChIP-Seq experiments, we find that Cohesin is dynamically recruited to the IgH locus during CSR and that knockdown of Cohesin or its regulatory subunits results in impaired CSR and abnormal DSB resolution. Our results are consistent with a model in which Cohesin controls the formation of long-range DNA loops at the IgH locus and the resolution of DSBs generated during CSR. Smc1, Smc3 and CTCF were immunoprecipitated from resting or in vitro activated B cells.

2013-10-11 | E-GEOD-43594 | biostudies-arrayexpress

Long-range joining of intra-chromosomal DNA double-strand breaks

Project description:Antibody class switch recombination (CSR) in B lymphocytes joins two DNA double-strand breaks (DSBs) lying 100 to 200 kilobases (kb) apart within switch (S) regions in the immunoglobulin heavy chain locus (IgH). CSR-activated B lymphocytes generate multiple S-region DSBs in the donor Sm and in a downstream acceptor S region, with a DSB in Sm being joined to a DSB in the acceptor S region at sufficient frequency to drive CSR in a large fraction of activated B cells. Such frequent joining of widely separated CSR DSBs could be promoted by IgH-specific or B cell-specific processes or by general aspects of chromosome architecture and DSB repair. Previously, we found that B cells with two yeast I-SceI endonuclease targets in place of Sg1 undergo I-SceI-dependent class switching from IgM to IgG1 at 5-10% of normal levels. Now, we report that B cells in which Sg1 is replaced with a 28 I-SceI target array, designed to increase I-SceI DSB frequency, undergo I-SceI-dependent class switching at almost normal levels. High-throughput genome-wide translocation sequencing revealed that I-SceI-generated DSBs introduced in cis at Sm and Sg1 sites are joined together in T cells at levels similar to those of B cells. Such high joining levels also occurred between I-SceI-generated DSBs within c-myc and I-SceI- or CRISPR/Cas9-generated DSBs 100 kb downstream within Pvt1 in B cells or fibroblasts, respectively. We suggest that CSR exploits a general propensity of intra-chromosomal DSBs separated by several hundred kb to be frequently joined together and discuss relevance of this finding for recurrent interstitial deletions in cancer. Comparison of frequency of long-range joining between I-SceI-induced DSBs at IgH and c-myc loci in different cell types by HTGTS

2014-01-03 | E-GEOD-53755 | biostudies-arrayexpress

The Chromatin Reader ZMYND8 Regulates Igh Enhancers to Promote Immunoglobulin Class Switch Recombination

Project description:Class Switch Recombination (CSR) is a DNA recombination reaction that diversifies the effector component of antibody responses. CSR is initiated by activation-induced cytidine deaminase (AID), which targets transcriptionally active immunoglobulin heavy chain (Igh) switch donor and acceptor DNA. The 3’ Igh super-enhancer, 3’ Regulatory Region (3’RR), is essential for acceptor region transcription, but how this function is regulated is unknown. Here we identify the chromatin reader ZMYND8 as an essential regulator of the 3’RR and CSR. In B cells, ZMYND8 binds promoters and super-enhancers, including the 3’RR, and controls its activity by modulating the enhancer transcriptional status. In its absence, there is increased 3’RR polymerase loading, and decreased acceptor region transcription and CSR. In addition to CSR, ZMYND8 deficiency impairs somatic hypermutation (SHM) of Igh, which is also dependent on the 3’RR. Thus ZMYND8 controls Igh diversification in mature B lymphocytes by regulating the activity of the 3’ Igh super-enhancer.

2018-10-04 | GSE118794 | GEO

Genome-wide localization of Smc1, Smc3 and CTCF in mouse B cells.

Project description:Immunoglobulin class switch recombination (CSR) is initiated by the transcription-coupled recruitment of activation induced cytidine deaminase (AID) to switch regions and by the subsequent generation and resolution of dsDNA breaks (DSBs). During, CSR the IgH locus undergoes dynamic three-dimensional structural changes in which promoters, enhancers and switch regions are brought to close proximity. Nevertheless, little is known about the underlying mechanisms. Here we show that during CSR, AID associates with subunits of cohesin, a complex previously implicated in DNA repair and in the formation of DNA loops between enhancers and promoters. By ChIP-Seq experiments, we find that Cohesin is dynamically recruited to the IgH locus during CSR and that knockdown of Cohesin or its regulatory subunits results in impaired CSR and abnormal DSB resolution. Our results are consistent with a model in which Cohesin controls the formation of long-range DNA loops at the IgH locus and the resolution of DSBs generated during CSR.

2013-10-11 | GSE43594 | GEO

A de novo transcription-dependent TAD boundary underpins critical multiway interactions during antibody class switch recombination [Micro-C]

Project description:Antibody class switch recombination (CSR) requires the ligation of DNA breaks in transcribed and juxtaposed donor and acceptor switch (S) sequences (S-S synapsis) spaced 50-200 kb apart within the immunoglobulin heavy chain locus (Igh). CSR is believed to occur via the association of active S regions with the 3’ regulatory region (3’RR) super-enhancer thereby coupling transcription with S-S synapsis. Here, we map the multi-way interactome underlying CSR using Tri-C. Surprisingly, S-S synapsis is strongly associated with the 3` CTCF binding element (3`CBE), but not the 3’RR, a finding also confirmed by Micro-C measurements. Instead, the 3’RR forms a self-interacting domain independently engaging with Igh genes. Additionally, transcription at acceptor S regions creates a topological barrier that insulates S-S synapsis from loop extrusion complexes. Thus, Igh gene activation and S-S synapsis occur via distinct topological states created by the interaction between transcription and the loop extrusion machinery.

2023-01-20 | GSE198181 | GEO

A de novo transcription-dependent TAD boundary underpins critical multiway interactions during antibody class switch recombination [PRO-seq]

2023-01-20 | GSE198180 | GEO

A de novo transcription-dependent TAD boundary underpins critical multiway interactions during antibody class switch recombination [Tri-C]

2023-01-20 | GSE198179 | GEO

A de novo transcription-dependent TAD boundary underpins critical multiway interactions during antibody class switch recombination [ChIP-Seq]

2023-01-20 | GSE198176 | GEO