IRF4, a master transcription factor, regulates genes involved in BCR signaling, antigen processing and presentation, and GC development [expression array]
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
PROVIDER: GSE64269 | GEO | 2015/12/15
SECONDARY ACCESSION(S): PRJNA270595
REPOSITORIES: GEO
Similar Datasets
Project description:Interferon regulatory factor 4 (IRF4) is a master transcription factor required for the maturation of germinal center B cells that eventually develop into antibody secreting plasma cells and memory B cells. IRF4-deficient mice exhibit a profound reduction in serum immunoglobulin levels. In spite of wealth of the information relating to IRF4 and B cell biology, little is known about the intricate molecular details of the role of this transcription factor during B cell development. We therefore examined the genome-wide targets of IRF4 by ChIP-chip analysis in GC derived BL2 Burkittâs lymphoma cells. ChIP studies were further supplemented by whole genome expression analysis after shRNA-mediated knockdown of IRF4. Our study revealed that IRF4 regulates expression of genes important for a) BCR signaling b) antigen processing and presentation by MHC. In addition we found that IRF4 possibly in some way involved to regulate LTA, LTB and CXCR5 those involved in immune system development, particularly light zone development related genes such as FDC clustering regulating and IL21R and IL10 who are involved in B cell development.. On the other hand, IRF4 suppressesd genes in the oxidative phosphorylation pathway. Our findings illuminate hitherto unexplored roles of IRF4 in GC B cell development. BL2 Burkitt's lymphoma-derived B cells were infected with lentivirus expressing shRNA for IRF4 or control, and total RNA was subjected to Illumina BeadsExpression Arrays analysis.
2015-12-15 | E-GEOD-64269 | biostudies-arrayexpress
Project description:Interferon regulatory factor 4 (IRF4) is a master transcription factor required for the maturation of germinal center B cells that eventually develop into antibody secreting plasma cells and memory B cells. IRF4-deficient mice exhibit a profound reduction in serum immunoglobulin levels. In spite of wealth of the information relating to IRF4 and B cell biology, little is known about the intricate molecular details of the role of this transcription factor during B cell development. We therefore examined the genome-wide targets of IRF4 by ChIP-chip analysis in GC derived BL2 Burkitt’s lymphoma cells. ChIP studies were further supplemented by whole genome expression analysis after shRNA-mediated knockdown of IRF4. Our study revealed that IRF4 regulates expression of genes important for a) BCR signaling b) antigen processing and presentation by MHC. In addition we found that IRF4 possibly in some way involved to regulate LTA, LTB and CXCR5 those involved in immune system development, particularly light zone development related genes such as FDC clustering regulating and IL21R and IL10 who are involved in B cell development.. On the other hand, IRF4 suppressesd genes in the oxidative phosphorylation pathway. Our findings illuminate hitherto unexplored roles of IRF4 in GC B cell development.
2015-12-15 | GSE64268 | GEO
Project description:Interferon regulatory factor 4 (IRF4) is a master transcription factor required for the maturation of germinal center B cells that eventually develop into antibody secreting plasma cells and memory B cells. IRF4-deficient mice exhibit a profound reduction in serum immunoglobulin levels. In spite of wealth of the information relating to IRF4 and B cell biology, little is known about the intricate molecular details of the role of this transcription factor during B cell development. We therefore examined the genome-wide targets of IRF4 by ChIP-chip analysis in GC derived BL2 Burkittâ??s lymphoma cells. ChIP studies were further supplemented by whole genome expression analysis after shRNA-mediated knockdown of IRF4. Our study revealed that IRF4 regulates expression of genes important for a) BCR signaling b) antigen processing and presentation by MHC. In addition we found that IRF4 possibly in some way involved to regulate LTA, LTB and CXCR5 those involved in immune system development, particularly light zone development related genes such as FDC clustering regulating and IL21R and IL10 who are involved in B cell development.. On the other hand, IRF4 suppressesd genes in the oxidative phosphorylation pathway. Our findings illuminate hitherto unexplored roles of IRF4 in GC B cell development. ChIP-chip was performed following the protocols described before [Lian Z, et al.,Genome Res. 18: 1224, 2008] with slight modifications. Briefly, 3X10^8 BL2 cells were cross-linked in 1% formaldehyde for 10 mins at room temperature and then the cells were lysed in RIPA buffer(0.1% SDS) containing protease inhibitors(Roche Inc) . Cell suspensions were sonicated under ice-cold conditions using a Branson 250 Sonifier (Branson, Danbury, CT) with a power setting 60%, fifteen 30-sec pulses on ice to shear the chromatin to a size of approximately 300-500b. Anti-IRF4 antibody (sc6059 Santa Cruz Biotechnology, Santa Cruz, CA) or normal pre-immune mouse serum IgG as a control were added to the suspensions. The suspension was incubated at 4C rotating overnight to allow the antibodies to bind to DNA fragments. Protein G beads were added next day and incubated at 4C with gentle agitation for 1 hr. The antibodyâ??DNA complexes were eluted from the beads by 1% SDS in TE incubated at 65°C. The beads were sedemented by centrifugation, and the supernatants were incubated overnight at 65°C to reverse the cross-linking in the chromatin-protein complex. RNA contamination was eliminated by incubating the samples with 200 mg of Rnase for 1 hour at 37°C. Finally, proteinase K (400 μg of proteinase K/mL, 1X TE) was added, and the samples were incubated for 2 h at 45°C, followed by a phenol/chloroform/isoamyl alcohol extraction and ethanol precipitation to recover the DNA. Immunoprecipitated DNA was analyzed by PCR for the enriched factor binding at target sequences. In some cases we did LM-PCR, about 20-100ng of the ChIP-DNA was blunt-ended by T4 DNA polymerase (New England Biolabs, Boston MA), then ligated with pre-annealed oligonucleotide linkers (oligo-1: GCGGTGACCCGGGAGATCTGAATTC, oligo-2: GAATTCAGATC) using T4 DNA ligase (New England Biolabs) at 16°C overnight. The ligated DNA was further amplified by PCR with oligo-1 as a PCR primer, followed by purification using the Qiaquick PCR purification kit (Qiagen). We used Nimblegen high density promoter arrays based on human genome HG17 (Nimblegen System INC. Reykjavik Iceland).Taq Mastermix (QIAGEN) was used for PCR amplification under the following reaction conditions: 5 min at 94°C, 30 cycles of 30 sec at 94°C, 30 sec at 53°C, 30 sec at 72°C, and 10 min at 72°C. PCR products were analyzed by gel electrophoresis. DNA samples to be hybridized to microarrays were labeled by random priming with nonamer oligonucleotides attached to Cy3 or Cy5 dyes. Control samples for the chromatin immunoprecipitation experiments were total genomic DNA prepared from chromatin cross-linked and precipitated by the same procedure as the test sample but with non-specific IgG.. Test samples were labeled with Cy5 and applied to the same chip as the Cy3-labeled control sample. ChIP DNA samples were randomly primed with Cy3 and Cy5 random nonomers or septamers and the labeled fragments were hybridized to the promoter arrays. Data analysis was carried out by Tilescope [Lian Z, et al.,Genome Res. 18: 1224, 2008] and Integrated Genome Browser (IGB). Nimblegen ChIP-chip data were processed by automated Tilescope analysis [Zhang ZD, et al., Genome Biol. 8: R81, 2007]. The program normalizes Cy3 and Cy5 files of the tiling array results and identifies regions with statistically significant binding enrichment. Visualization and further analysis of the data were carried out using the IGB program (http://www.affymetrix.com/partners_programs/programs/developer/tools/download_igb.affx) and Database for Annotation, Visualization and Integrated Discovery (http://david.abcc.ncifcrf.gov/summary.jsp).
2015-12-15 | E-GEOD-64268 | biostudies-arrayexpress
Project description:Follicular dendritic cells (FDC) are important stromal cells within the B cell follicles and germinal centres (GC) of secondary lymphoid tissues. FDC trap and retain native antigens on their surfaces in the form of immune complexes which they display to B cells, in order to select those cells with the highest antigen affinity. MicroRNAs are short, non-coding RNAs of approximately 18-25 nucleotides in length that regulate gene expression at the post-transcriptional level by repressing the translation of target genes. In the current study in vivo and in vitro systems were used to identify microRNAs that are differentially expressed as a result of FDC depletion. Constitutive lymphotoxin-β receptor (LTβR) stimulation is required to maintain FDC in their differentiated state. We show that the rapid de-differentiation of spleen FDC that followed LTβR-blockade, coincided with a significant decrease in the expression of mmu-miR-100-5p, mmu-miR-138-5p and mmu-miR-2137. These microRNAs were shown to be expressed in the FDC-like cell line, FL-YB, and specific inhibition of mmu-miR-100-5p significantly enhanced expression of Il6, Ptgs1/2 and Tlr4 in this cell line. The expression of each of these genes by FDC plays an important role in regulating GC size and promoting high-affinity antibody responses, suggesting that mmu-miR-100-5p may help regulate their expression during GC reactions. C57BL/6 mice were given a single intravenous injection of 100 µg of LTβR to temporarily deplete their FDC. At intervals after treatment 4 spleens from each group were harvested and RNA prepared. For each group samples were pooled into 2 groups of 2 and microRNA expression levels compared. Spleens from LTb-/- mice were also analysed.
2014-06-20 | E-GEOD-55720 | biostudies-arrayexpress
Project description:Follicular dendritic cells (FDC) are important stromal cells within the B cell follicles and germinal centres (GC) of secondary lymphoid tissues. FDC trap and retain native antigens on their surfaces in the form of immune complexes which they display to B cells, in order to select those cells with the highest antigen affinity. MicroRNAs are short, non-coding RNAs of approximately 18-25 nucleotides in length that regulate gene expression at the post-transcriptional level by repressing the translation of target genes. In the current study in vivo and in vitro systems were used to identify microRNAs that are differentially expressed as a result of FDC depletion. Constitutive lymphotoxin-M-NM-2 receptor (LTM-NM-2R) stimulation is required to maintain FDC in their differentiated state. We show that the rapid de-differentiation of spleen FDC that followed LTM-NM-2R-blockade, coincided with a significant decrease in the expression of mmu-miR-100-5p, mmu-miR-138-5p and mmu-miR-2137. These microRNAs were shown to be expressed in the FDC-like cell line, FL-YB, and specific inhibition of mmu-miR-100-5p significantly enhanced expression of Il6, Ptgs1/2 and Tlr4 in this cell line. The expression of each of these genes by FDC plays an important role in regulating GC size and promoting high-affinity antibody responses, suggesting that mmu-miR-100-5p may help regulate their expression during GC reactions. C57BL/6 mice were given a single intravenous injection of 100 M-BM-5g of LTM-NM-2R to temporarily deplete their FDC. At intervals after treatment 4 spleens from each group were harvested and RNA prepared. For each group samples were pooled into 2 groups of 2 and microRNA expression levels compared. Spleens from LTb-/- mice were also analysed. One channel was used for the actual sample, the second channel was used for internal QC reference.
2014-06-20 | E-GEOD-55721 | biostudies-arrayexpress
Project description:Comparison of follicular dendritic cell-enriched versus -depleted splenocytes. Affinity maturation and Ab class switches occur in lymphoid germinal centers (GCs), in which differentiation and maintenance depend on lymphotoxin (LT) signaling and include differentiation of follicular dendritic cells (FDCs). The events leading to FDC and GC maturation are poorly defined. Using several approaches of functional genomics, we enumerated transcripts affected in mice by suppressing LT receptor (LTR) signaling and/or overrepresented in FDC-enriched GC isolates. Protein expression analysis of 3 of 12 genes both enriched in FDCs and down-regulated by LTR signaling suppression validated them as FDC markers. Functional analysis of one of these three, clusterin, suggests a role as an FDC-derived trophic factor for GC B cells. Hence, the set of genes presented in this study includes markers emanating from LTR signaling and transcripts relevant to GC and FDC function.
2007-09-21 | E-GEOD-2123 | biostudies-arrayexpress
Project description:Follicular dendritic cells (FDC) are important stromal cells within the B cell follicles and germinal centres (GC) of secondary lymphoid tissues. FDC trap and retain native antigens on their surfaces in the form of immune complexes which they display to B cells, in order to select those cells with the highest antigen affinity. MicroRNAs are short, non-coding RNAs of approximately 18-25 nucleotides in length that regulate gene expression at the post-transcriptional level by repressing the translation of target genes. In the current study in vivo and in vitro systems were used to identify microRNAs that are differentially expressed as a result of FDC depletion. Constitutive lymphotoxin-β receptor (LTβR) stimulation is required to maintain FDC in their differentiated state. We show that the rapid de-differentiation of spleen FDC that followed LTβR-blockade, coincided with a significant decrease in the expression of mmu-miR-100-5p, mmu-miR-138-5p and mmu-miR-2137. These microRNAs were shown to be expressed in the FDC-like cell line, FL-YB, and specific inhibition of mmu-miR-100-5p significantly enhanced expression of Il6, Ptgs1/2 and Tlr4 in this cell line. The expression of each of these genes by FDC plays an important role in regulating GC size and promoting high-affinity antibody responses, suggesting that mmu-miR-100-5p may help regulate their expression during GC reactions.
2014-06-20 | GSE55721 | GEO
Project description:Follicular dendritic cells (FDC) are important stromal cells within the B cell follicles and germinal centres (GC) of secondary lymphoid tissues. FDC trap and retain native antigens on their surfaces in the form of immune complexes which they display to B cells, in order to select those cells with the highest antigen affinity. MicroRNAs are short, non-coding RNAs of approximately 18-25 nucleotides in length that regulate gene expression at the post-transcriptional level by repressing the translation of target genes. In the current study in vivo and in vitro systems were used to identify microRNAs that are differentially expressed as a result of FDC depletion. Constitutive lymphotoxin-β receptor (LTβR) stimulation is required to maintain FDC in their differentiated state. We show that the rapid de-differentiation of spleen FDC that followed LTβR-blockade, coincided with a significant decrease in the expression of mmu-miR-100-5p, mmu-miR-138-5p and mmu-miR-2137. These microRNAs were shown to be expressed in the FDC-like cell line, FL-YB, and specific inhibition of mmu-miR-100-5p significantly enhanced expression of Il6, Ptgs1/2 and Tlr4 in this cell line. The expression of each of these genes by FDC plays an important role in regulating GC size and promoting high-affinity antibody responses, suggesting that mmu-miR-100-5p may help regulate their expression during GC reactions.
2014-06-20 | GSE55720 | GEO
Project description:The transcription factor IRF4 regulates immunoglobulin class switch recombination and plasma cell differentiation. Its differing concentrations appear to regulate mutually antagonistic programs of B and plasma cell gene expression. We show IRF4 to be also required for generation of germinal center (GC) B cells. Its transient expression in vivo induced the expression of key GC genes including Bcl6 and Aicda. In contrast, sustained and higher concentrations of IRF4 promoted the generation of plasma cells while antagonizing the GC fate. IRF4 cobound with the transcription factors PU.1 or BATF to Ets or AP-1 composite motifs, associated with genes involved in B cell activation and the GC response. At higher concentrations, IRF4 binding shifted to interferon sequence response motifs; these enriched for genes involved in plasma cell differentiation. Our results support a model of "kinetic control" in which signaling-induced dynamics of IRF4 in activated B cells control their cell-fate outcomes. Regrettably three of the FASTQ raw sequence files in our study were corrupted during storage. FASTQ data from our experimental and control groups are available for download via GEO SRA; however, two groups are missing select raw sequence files. These include one PU.1 Day 3 group file (Sample GSM1133499) and two of four input files used to generate a concatenated “super” input file (Sample GSM1133490); the raw data provided for input consists of the two input files recovered. Importantly, FASTA sequences for both of these datasets are available as supplementary data through GEO, and we can make available upon request (rsciamma@uchicago.edu) all files in our study in the ELAND-extended alignment format. Please note that GEO no longer supports this format.
2013-05-04 | GSE46608 | GEO
Project description:Neural signals are known to contribute to immune regulation and modulation of the innate immune response downstream of the vagus nerve has been well studied. The effects of vagus nerve activity on antibody production, however, have been largely unexplored. Here we use a chronic vagus nerve stimulation (VNS) mouse model to study the effect of vagal activation on T-dependent B cell responses. We observed lower titers of high-affinity serum IgG and fewer antigen-specific germinal center (GC) B cells in the spleen. GC B cells from chronic VNS mice expressed more active caspase-3 and exhibited an altered gene expression profile suggesting increased susceptibility to apoptosis and impaired maturation. Follicular dendritic cell (FDC) cluster dispersal and altered FDC gene expression suggested poor FDC function. These alterations were diminished in the absence of a subset of acetylcholine-producing CD4+ T cells. In vitro studies revealed that α7 and α9 nicotinic acetylcholine receptors (nAChRs) directly regulated B cell production of TNF, a cytokine crucial to FDC clustering. Engagement of the α4 nAChR subunit on B cells impaired Akt phosphorylation, presumably decreasing B cell survival. Thus, VNS-induced GC impairment can be attributed, at least in part, to the effect of acetylcholine on B cell intrinsic pathways, resulting in hindered B cell survival and maturation and leading to an alteration in FDC function. Our findings identify a potential therapeutic target to prevent immunosuppression in conditions associated with increased vagal activity.
2023-10-25 | GSE246196 | GEO