Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Next Generation Sequencing profile of leukemia from distinct cells-of-origin [Transcriptome profiles]

ABSTRACT: The goal of this study is to identify genomic signatures predicitve of cell-of-origin in acute myeloid leukemia 50K bulk leukemia (GFP+) cells from the spleen of recipient mice were sorted directly into 350μl of RLT buffer (Qiagen) and flash-frozen. Total RNA was isolated according to manufacturer’s protocols (Qiagen) including DNase treatment, and quality was assessed using an Agilent 2100 Bioanalyzer and RNA 6000 Nano kit. Amplified cDNA was sheared to approximately 300bp using a Covaris E220 Focused Ultrasonicator. RNA-seq library preparation used the TruSeq DNA sample prep kit v2 (Illumina). Libraries were sequenced on the Illumina HiSeq 2000 platform.

ORGANISM(S): Mus musculus

PROVIDER: GSE74690 | GEO | 2016/07/12

SECONDARY ACCESSION(S): PRJNA301163

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Similar Datasets

EWS-Fli and LNC regulated genes in comparison to GFP samples

Project description:RNA from A673 cells with shRNA-mediated knockdown of GFP (4 libraries), EWS-FLI1 (4 libraries), or lnc277 (7 libraries) was isolated with TRIzol (Invitrogen). Each sample was DNase treated and further purified on an RNeasy Mini column (Qiagen) before quality analysis on an Agilent 2100 Bioanalyzer. For each sample, 100-150ng of RNA was synthesized into cDNA, sheared on a Covaris ultrasonicator, and amplified using the NuGen Encore Complete kit (NuGen) to produce strand-specific and rRNA-depleted libraries. Samples were multiplexed (4/lane) for 2x100bp paired-end sequencing on an Illumina HiSeq 2000

2014-11-01 | GSE60949 | GEO

B Cell Methylome

Project description:Mouse B cells were isolated from the spleen and activated ex vivo. DNA was obtained from activated and control B cells with the Qiagen AllPrep kit. 1ug of DNA was sonicated with the Covaris Sonicator (300bp) and the Illumina library was prepared following a standard Illumina protocol with the NEB Next kit. The library was amplified 15x and gel-excised within the range of 200-500bp. This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/

2013-03-25 | E-ERAD-90 | biostudies-arrayexpress

ESC Methylome Dynamics

Project description:Mouse Embryonic Stem Cells (ESCs) are grown in culture and seperated based upon heterogeneous expression of key pluripotency factors. DNA was obtained from cells with the Qiagen AllPrep kit. 0.2ug of DNA was sonicated with the Covaris Sonicator (300bp) and the Illumina library was prepared following a standard Illumina protocol with the NEB Next kit. The library was amplified 15x and size-selected within the range of 200-500bp. This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/

2013-08-07 | E-ERAD-178 | biostudies-arrayexpress

Methylome and Hydroxymethylome of iPSC

Project description:Induced Pluripotent Stem Cells (iPSC) were obtained from primary embryonic fibroblast form mice of different genetic backgrounds. DNA was obtained from cells with the Qiagen AllPrep kit. 0.25ug of DNA was sonicated with the Covaris Sonicator (300bp) and the Illumina libraries were prepared following the TrueMethyl 6 protocol and libraries amplified 10x. This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/

2014-01-07 | E-ERAD-208 | biostudies-arrayexpress

Integration sites sequencing of HIV infection on ZNF417 ZNF587 dKO 293T cells

Project description:We infected ZNF417 ZNF587 dKO 293T or control 293T with NL4.3 virus for 48 hours. Then genomic DNA was purified from cell lysis with by phenol chloroform. DNA was sheared into 300 bp-500 bp random fragments using Covaris Adaptive Focused Acoustics (Covaris, Woburn, MA). Sheared DNA was ligated with a linker and PCR with primers targeting HIV LTR and linker. PCR products were performed second PCR with Illumina adaptor primers. Libraries were so constructed and sequenced on Novaseq 6000.

2021-12-31 | GSE174239 | GEO

EWS-Fli and LNC regulated genes in comparison to GFP samples

2014-11-01 | E-GEOD-60949 | biostudies-arrayexpress

Reprogramming around an epigenetic barrier with TET1

Project description:Mouse Epiblast Stem Cells (EpiSCs) were reprogrammed to induced pluripotent stem cells (iPSCs) by overexpression of key pluripotency factors and the TET1 DNA hydroxylase. 0.2ug of extractd DNA was sonicated using the Covaris Sonicator (300bp) and the Illumina library was prepared following a standard Illumina protocol with the NEB Next kit and subjected to bisulfite treament. The library was amplified 12x and fragments smaller than 200 bp were removed by PEG precipitation on magnetic beads. This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/

2014-04-28 | E-ERAD-238 | biostudies-arrayexpress

Transcriptional profiling (RNA-seq) of wild-type and Arhgap35 knockout embryonic motor neurons (E12.5)

Project description:Ventral spinal cord regions micro-dissected from E12.5 Arhgap35 (aka, p190) knockout embryos or control littermates (wild-type or p190+/-) were pulled and dissociated with papain (Worthington Biochemical Cat# LK003153) according to the manufacturer’s instructions. Cells were sorted on a Becton Dickinson FACS Vantage SE DiVa using Coherent Sapphire 488 nm solid state laser and collected directly into RLT lysis buffer containing β-mercaptoethanol (Qiagen). RNA was isolated using the RNeasy Mini Kit (Qiagen) with on-column DNase digestion (Qiagen RNase-Free DNase Set). Each sample contained between 100,000 and 200,000 GFP+ motor neurons isolated from 2-5 spinal cords during a single experimental session. Five p190-/- and five control RNA samples were quantified with Agilent 2200 TapeStation system prior to preparation of mRNA-sequencing libraries (50 bp single-end) using the Illumina TruSeq RNA Library Preparation Kit (v2) according to the manufacturer’s instructions. Libraries were sequenced with Illumina HiSeq 2500 platform. "Negative" samples are from FACS-sorted Hb9:GFP-negative cells.

2019-05-01 | GSE126534 | GEO

Intrahepatic MAIT cell gene expression revealed by RNA-seq

Project description:RNA-seq was carried out as described by Simone Picelli et al. with minor modifications (Genome Res 2014;24:2033-40). Briefly, RNA was extracted from 5000 cells using a miRNeasy Micro Kits (Qiagen, German). RNA quality was assessed with an Agilent RNA 6000 Pico Kit (Agilent Technologies, cat#5067-1513, USA) on an Agilent 2100 Bioanalyzer. Each library was prepared from 2ng of total RNA. After reverse transcription, cDNA was amplified for 8 cycles followed by Agencourt AMPure XP purification, the quality of cDNA library was checked on an Agilent High Sensitivity DNA Kit (Agilent Technologies, cat#5067-4626). The cDNA was sheared to a 200-500 bp size range using the Covaris AFA system. The final library was carried out by using the NEB Next ULTRA II DNA Prep Kit, and their quality and size were checked using the Agilent High Sensitivity DNA Kit. The libraries were sequenced using a Hiseq 4000 system (Illumina, USA). At least million reads were obtained for each sample. For all RNA-seq reads, we cut the 5’ adaptor (AAGCAGTGGTATCAACGCAGAGTACAT GGG) using cutadapt (version 1.10) with the parameter –e 0.17, and then aligned to the hg19 genome using OSA (version 2.10.8). The aligned data were merged and count by Samtools (version 0.1.19+), and differentially expressed genes were found based on the edgeR with default parameters (Bioinformatics 2010;26:139-40). A gene was differentially expressed if (1) p < 0.05 (2) |log2(fold change)| > 1. For hierarchical clustering, the RPKM values of differentially expressed genes were log2-transformed and standardized. 1- Pearson correlation was then used as the distance for clustering. Differentially expressed genes were selected for GO analysis using R package clusterProfiler (Omics 2012;16:284-7).

2018-12-01 | GSE117627 | GEO

mRNA Sequencing of control and huntington's disease iPSC-derived medium spiny neuron-like cells and Q175 HET or WT mice. Plus and minus knockdown of PIAS1.

Project description:HD and control patient-derived induced pluripotent stem cells were used to generate medium spiny neuron-like cells. four control in duplicate and three HD samples in duplicate with CAG repeat length in juvenile onset range were differentiated as biological growth replicates (separate differentiations) into medium spiny neuron-like cells. Cells were treated with LNPs with siRNA for knockdown of PIAS1 or a luciferase control. Total RNA was isolated using the Qiagen RNeasy Kit and QIAshredders for cell lysis. For mouse data WT and HET GFP+ micro-dissected flash frozen brain regions (striatum) were homogenized in TRIzol reagent (Invitrogen) and RNA were collected and purified using RNEasy Mini kit (Qiagen). Mice were treated with AAV2/1 expressing either a miRNA against Pias1 (miPias1.3), a control scrambled miRNA (miSafe). 1 µg of RNA with RIN values >8 were used for library preparation using the strand specific Illumina TruSeq mRNA protocol. Libraries were sequenced on the HiSeq 4000 using 100 cycles to obtain paired-end 100 reads.

2021-01-01 | GSE162349 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data