Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Transcriptional effect of ETV1 knockdown in melanoma cells

ABSTRACT: ETV1 is amplified in a subset of melanomas. Here, we performed RNA-seq on two BRAF V600E mutant melonoma cell lines transduced with a scrambed shRNA and two individual ETV1 shRNA

ORGANISM(S): Homo sapiens

PROVIDER: GSE80352 | GEO | 2018/04/15

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Comparing gene expression profiles of pigmented and amelanotic (MPNST-like) melanomas arising in the genetically engineered BRAF(V600E)-Cdk4(R24C) mouse melanoma model

Project description:We found that pigmented and amelanotic (MPNST-like) melanomas arise in the genetically engineered BRAF(V600E)-Cdk4(R24C) mouse melanoma model and even in the same animal. To explore the molecular differences between the two type of melanomas in this model we performed global gene expression profiling and pathway analysis to compare the underlying mechanisms. This information was used to identify human melanomas that resemble each type of the mouse melanomas found in the in the genetically engineered BRAF(V600E)-Cdk4(R24C) mouse melanoma model.

2015-12-01 | GSE71879 | GEO

Gene expression profile of ETV1 knockdown in LNCaP prostate cancer cells

Project description:Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after infection and gene expression profiling was performed. Among genes downregulated were many well characterized androgen regulated genes.

2013-05-10 | GSE46329 | GEO

ETV1 knockdown in GIST cell lines

Project description:ETV1 is highly expressed in GIST cells and required for their survival and growth. To identify genes and pathways regulated by ETV1 in GIST, we performed expression profiles of GIST cells after ETV1 knockdown. Two GIST cell lines (GIST48 and GIST882) were infected in duplicate with three shRNA viruses (Scrambled, ETV1sh1-B11TRCN0000013923, ETV1sh2-TRCN0000013925). Four days after infection, RNA was harvested for expression profiling.

2010-10-13 | E-GEOD-19396 | biostudies-arrayexpress

Gene expression profile of ETV1 knockdown in LNCaP prostate cancer cells

2013-05-10 | E-GEOD-46329 | biostudies-arrayexpress

Endogenous RAC1 P29S in mouse melanoma

Project description:We studied the effects of endogenous expression of the melanoma oncogene RAC1 P29S in BRAF V600E;PTEN hemizygous mouse melanomas.

2018-08-10 | GSE118344 | GEO

Expression analysis of melanoma harvested from GFP versus SETDB1 transgenic zebrafish (Danio rerio)

Project description:Investigation of expression differences between melanomas harvested from MiniCoopR-GFP versus MiniCoopR-SETDB1 transgenic zebrafish. An eight-chip study using total RNA prepared from four distinct melanomas from zebrafish injected with MiniCoopR-GFP (control) transposon and four distinct melanomas from zebrafish injected with MiniCoopR-SETDB1 transposon. Injected animals carried a p53 loss-of-function mutation, a mutation in nacre, and an mitf:BRAF-V600E transgene. Each chip measures the expression level of 32,292 genes.

2011-01-07 | E-GEOD-21505 | biostudies-arrayexpress

Mapping of ETV1 genomic binding sites in gastrointestinal stromal tumor (GIST).

Project description:ETV1 is highly expressed in GIST and their presumed precursors--the interstitial cells of Cajal. ETV1 is required for survival for both GIST and ICC and regulates GIST signature genes. Here, using Illumina-Solexa based next-generation sequencing of ETV1 chromatin immunoprecipates (ChIP-Seq), we define ETV1 binding sites in the GIST48 cell line. Crosslinked ChIP using input control ETV1 ChIP in GIST48 cells. Details: GIST48 cells were crosslinked for 15-minutes in 1% parformaldehyde. Cells were lysed and chromatin sheared using bioruptor. Sheared chromatin was incubated with anti-rabbit IgG dynabeads pre-conjugated with anti-ETV1 antibody (Abcam Ab81086, Lot 787879), washed, eluted, reverse cross-linked, and purified. Purified ChIP DNA was blunt-ended, ligated to Solexa adaptors, amplified with 18-cycles of PCR, and sequenced on Solexa Genome Analyzer. All reads (~36-bp) from ChIP-Seq were aligned to the human genome (build 36, or hg18) using the ELAND alignment software within the Illumina Analysis Pipeline. Unique reads mapped to a single best-matching location with no more than two mismatches were kept and used to generate genome-wide distribution of ETV1-binding and for peak identification. Redundant reads were considered once.

2010-10-14 | E-GEOD-22441 | biostudies-arrayexpress

Expression profiling of mouse primary prostate luminal cells from WT and T-ETV1 mice, which contains human ETV1 cDNA under the endogenous Tmprss2 promoter.

Project description:Chromosomal rearrangements involving ETS factors, ERG and ETV1, occur frequently in prostate cancer. We here examine mouse prostate cells from WT mice with s with T-ETV1 mice, which contains express the truncated human ETV1 under the endogenous Tmprss2 promoter. ETV1 expression can be tracked by GFP expression. Primary prostate cells were isolated and luminal prostate cells were FACS-sorted by CD49F+ Sca1- from the lineage (CD31, CD45, Ter119) negative fraction. Total RNA was extracted from three biological replicates, and amplified using NuGEN V2cDNA amplification kit. This was used to hybridize to Affymetrix expression arrays using the Mouse Genome 430 2.0 platform.

2013-03-01 | E-GEOD-39355 | biostudies-arrayexpress

Gene expression profiling of prostate cancer cells upon JMJD2A or ETV1 knockdown

Project description:Gene expression profiling of LNCaP prostate cancer cells that have JMJD2A knockdown (JMJD2A shRNA #3; JMJD2A shRNA #5) or ETV knockdown (ETV shRNA #1; ETC shRNA #5) were compared to non-targeted control (sh-cm) cells. Total RNA was isolated from transformed LNCaP human prostate cancer cells containing a non-trageting control vector (sh-cm), vectors containing shRNA sequences for JMJD2A or ETV1 genes.

2014-01-01 | E-GEOD-47750 | biostudies-arrayexpress

ETV1 knockdown in GIST cell lines

2010-10-13 | GSE19396 | GEO