Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome

Project description:Synthetic DNA-binding proteins have found broad application in gene therapies and as tools for interrogating biology. Engineered proteins based on the CRISPR/Cas9 and TALE systems have been used to alter genomic DNA sequences, control transcription of endogenous genes, and modify epigenetic states. Although the activity of these proteins at their intended genomic target sites have been assessed, the genome-wide effects of their action have not been extensively characterized. Additionally, the role of chromatin structure in determining the binding of CRISPR/Cas9 and TALE proteins to their target sites and the regulation of nearby genes is poorly understood. Characterization of the activity these proteins using modern high-throughput genomic methods would provide valuable insight into the specificity and off-target effects of CRISPR- and TALE-based genome engineering tools. We have analyzed the genome-wide effects of TALE- and CRISPR-based transcriptional activators targeted to the promoters of two different endogenous human genes in HEK293T cells using a variety of high-throughput DNA sequencing methods. In particular, we assayed the DNA-binding specificity of these proteins and their effects on the epigenome. DNA-binding specificity was evaluated by ChIP-seq and RNA-seq was used to measure the specificity of these activators in perturbing the transcriptome. Additionally, DNase-seq was used to identify the chromatin state at target sites of the synthetic transcriptional activators and the genome-wide chromatin remodeling that occurs as a result of their action. Our results show that these genome engineering technologies are highly specific in both binding to their promoter target sites and inducing expression of downstream genes when multiple activators bind to a single promoter. Moreover, we show that these synthetic activators are able to induce the expression of silent genes in heterochromatic regions of the genome by opening regions of closed chromatin and decreasing DNA methylation. Interestingly, the transcriptional activation domain was not necessary for DNA-binding or chromatin remodeling in these regions, but was critical to inducing gene expression. This study shows that these CRISPR- and TALE-based transcriptional activators are exceptionally specific. Although we detected limited binding of off-target sites in the genome and changes to genome structure, these off-target event did not lead to any detectable changes in gene regulation. Collectively, these results underscore the potential for these technologies to make precise changes to gene expression for gene and cell therapies or fundamental studies of gene function. HEK293T cells were transfected in triplicate with plasmids expressing synthetic transcription factors. The synthetic TFs were either (a) dCas9-VP64 fusion protein and a targeting guide RNA (gRNA), or (b) a TALE-VP64 fusion protein engineered to bind to a specific target site in the genome. As a control, cells were transfected with plasmids expressing GFP. After transfection, RNA-seq was used to identify both on-target and off-target binding sites for the synthetic TFs. The data in this submission were generated using the TALE transfection experiments.

Project description:Synthetic DNA-binding proteins have found broad application in gene therapies and as tools for interrogating biology. Engineered proteins based on the CRISPR/Cas9 and TALE systems have been used to alter genomic DNA sequences, control transcription of endogenous genes, and modify epigenetic states. Although the activity of these proteins at their intended genomic target sites have been assessed, the genome-wide effects of their action have not been extensively characterized. Additionally, the role of chromatin structure in determining the binding of CRISPR/Cas9 and TALE proteins to their target sites and the regulation of nearby genes is poorly understood. Characterization of the activity these proteins using modern high-throughput genomic methods would provide valuable insight into the specificity and off-target effects of CRISPR- and TALE-based genome engineering tools. We have analyzed the genome-wide effects of TALE- and CRISPR-based transcriptional activators targeted to the promoters of two different endogenous human genes in HEK293T cells using a variety of high-throughput DNA sequencing methods. In particular, we assayed the DNA-binding specificity of these proteins and their effects on the epigenome. DNA-binding specificity was evaluated by ChIP-seq and RNA-seq was used to measure the specificity of these activators in perturbing the transcriptome. Additionally, DNase-seq was used to identify the chromatin state at target sites of the synthetic transcriptional activators and the genome-wide chromatin remodeling that occurs as a result of their action. Our results show that these genome engineering technologies are highly specific in both binding to their promoter target sites and inducing expression of downstream genes when multiple activators bind to a single promoter. Moreover, we show that these synthetic activators are able to induce the expression of silent genes in heterochromatic regions of the genome by opening regions of closed chromatin and decreasing DNA methylation. Interestingly, the transcriptional activation domain was not necessary for DNA-binding or chromatin remodeling in these regions, but was critical to inducing gene expression. This study shows that these CRISPR- and TALE-based transcriptional activators are exceptionally specific. Although we detected limited binding of off-target sites in the genome and changes to genome structure, these off-target event did not lead to any detectable changes in gene regulation. Collectively, these results underscore the potential for these technologies to make precise changes to gene expression for gene and cell therapies or fundamental studies of gene function. HEK293T cells were transfected in triplicate with plasmids expressing synthetic transcription factors. The synthetic TFs were either (a) dCas9-VP64 fusion protein and a targeting guide RNA (gRNA), or (b) a TALE-VP64 fusion protein engineered to bind to a specific target site in the genome. As a control, cells were transfected with plasmids expressing GFP. After transfection, ChIP-seq was used to identify both on-target and off-target binding sites for the synthetic TFs.

			Action	DRS
		Other
	GSE80611_RAW.tar	Raw
	filelist.txt	Txt

Dataset Information

Comparative Analysis of Cas9 Activators Across Multiple Species

Dataset's files

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets