Transcriptomics

Dataset Information

0

Identification of differentially-expressed genes between FoxH1 morpholino and control in zebrafish embryos.


ABSTRACT: The Forkhead Box H1 (FoxH1) protein is a co-transcription factor recruited by phosphorylated Smad2 downstream of several TGFbetas, including Nodal-related proteins. We have reassessed the function of zebrafish FoxH1 using antisense morpholino oligonucleotides (MOs) ( 5’ TGCTTTGTCATGCTGATGTAGTGGG 3’) as compared with a control morpholino (MO) with no specific target (5’ TAGTTAAGCCTAGCTCTCATAAACT 3’). Probing FoxH1 morphant RNA by microarray, we identified a cohort of five keratin genes – cyt1, cyt2, krt4, krt8 and krt18 - that are normally transcribed in the embryo’s enveloping layer (EVL) and which have significantly reduced expression in FoxH1-depleted embryos. Keywords: 40% epiboly-stage embryos, injected with either 8 ng of a 25mer morpholino (MO) with no specific target or 8 ng of a 25mer MO with reverse complementary to the 5’ untranslated region of the zebrafish foxH1 gene.

ORGANISM(S): Danio rerio

PROVIDER: GSE8076 | GEO | 2007/07/30

SECONDARY ACCESSION(S): PRJNA100913

REPOSITORIES: GEO

Dataset's files

Source:
Action DRS
Other
Items per page:
1 - 1 of 1

Similar Datasets

2014-11-07 | GSE53653 | GEO
2015-04-08 | GSE67648 | GEO
2009-03-28 | E-MEXP-2100 | biostudies-arrayexpress
2019-07-18 | GSE133990 | GEO
| PRJNA601459 | ENA
2011-08-23 | E-GEOD-30146 | biostudies-arrayexpress
2022-08-04 | GSE204990 | GEO
2011-08-23 | GSE30146 | GEO
2011-12-28 | E-GEOD-34683 | biostudies-arrayexpress
2011-12-17 | GSE34508 | GEO