Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Targeted interference of sin3a-tgif1 function by SID decoy treatment inhibits WNT signaling and invasion in triple negative breast cancer cells

ABSTRACT: Targeted interference of sin3a-tgif1 function by SID decoy treatment inhibits WNT signaling and invasion in triple negative breast cancer cells. MDA-MB-231 cells were treated with scrambled SID control, 2.5µM SID peptide or untreated for 24h.

ORGANISM(S): Homo sapiens

PROVIDER: GSE84648 | GEO | 2016/07/21

SECONDARY ACCESSION(S): PRJNA330729

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Similar Datasets

Targeted interference of sin3a-tgif1 function by SID decoy treatment inhibits WNT signaling and invasion in triple negative breast cancer cells

Project description:Targeted interference of sin3a-tgif1 function by SID decoy treatment inhibits WNT signaling and invasion in triple negative breast cancer cells. MDA-MB-231 cells were treated with scrambled SID control, 2.5ÂµM SID peptide or untreated for 24h. Sub-confluent cultures of MDA-MB-231 cells were treated with scrambled SID control, 2.5ÂµM SID peptide or untreated for 24h. Experiments were performed as three independent replicates.

2016-07-21 | E-GEOD-84648 | biostudies-arrayexpress

Targeted interference of SIN3A-TGIF1 function by SID decoy treatment inhibits Wnt signaling and invasion in triple negative breast cancer cells.

Project description: Not available

| S-EPMC5687616 | biostudies-literature

Cell cycle motif decoy oligos

Project description:Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do).

2012-08-23 | GSE39572 | GEO

Cell cycle motif decoy oligos

2012-08-23 | E-GEOD-39572 | biostudies-arrayexpress

Targeting the SIN3A-PF1 Interaction inhibits Epithelial to Mesenchymal Transition and Maintenance of a Stem Cell Phenotype in Triple Negative Breast Cancer (Expression)

Project description:Triple negative breast cancer (TNBC) is characterized by a poorly differentiated phenotype and limited treatment options. Aberrant epigenetics in this subtype represent a potential therapeutic opportunity, but a better understanding of the mechanisms contributing to the TNBC pathogenesis is required. The SIN3 molecular scaffold performs a critical role in multiple cellular processes, including epigenetic regulation, and has been identified as a potential therapeutic target. Using a competitive peptide corresponding to the SIN3 interaction domain of MAD (Tat-SID), we investigated the functional consequences of selectively blocking the paired amphipathic helix (PAH2) domain of SIN3. Here, we report the identification of the SID-containing adaptor PF1 as a factor required for maintenance of the TNBC stem cell phenotype and epithelial to mesenchymal transition (EMT). Tat-SID peptide blocked the interaction between SIN3A and PF1, leading to epigenetic modulation and transcriptional downregulation of TNBC stem cell and EMT markers. Importantly, Tat-SID treatment led to a reduction in primary tumor growth and disseminated metastatic disease in vivo. In support of these findings, knockdown of PF1 expression phenocopied treatment with Tat-SID both in vitro and in vivo. These results demonstrate a critical role for a complex containing SIN3A and PF1 in TNBC and provide a rational for its therapeutic targeting. Sub-confluent cultures of MDA-MB-231 cells were treated with 1ÂµM Tat-SID peptide or 1ÂµM Tat-Scr scrambled control peptide for 24hr.

2015-11-02 | E-GEOD-73278 | biostudies-arrayexpress

Targeting the SIN3A-PF1 Interaction inhibits Epithelial to Mesenchymal Transition and Maintenance of a Stem Cell Phenotype in Triple Negative Breast Cancer (MNase-seq)

Project description:Triple negative breast cancer (TNBC) is characterized by a poorly differentiated phenotype and limited treatment options. Aberrant epigenetics in this subtype represent a potential therapeutic opportunity, but a better understanding of the mechanisms contributing to the TNBC pathogenesis is required. The SIN3 molecular scaffold performs a critical role in multiple cellular processes, including epigenetic regulation, and has been identified as a potential therapeutic target. Using a competitive peptide corresponding to the SIN3 interaction domain of MAD (Tat-SID), we investigated the functional consequences of selectively blocking the paired amphipathic helix (PAH2) domain of SIN3. Here, we report the identification of the SID-containing adaptor PF1 as a factor required for maintenance of the TNBC stem cell phenotype and epithelial to mesenchymal transition (EMT). Tat-SID peptide blocked the interaction between SIN3A and PF1, leading to epigenetic modulation and transcriptional downregulation of TNBC stem cell and EMT markers. Importantly, Tat-SID treatment led to a reduction in primary tumor growth and disseminated metastatic disease in vivo. In support of these findings, knockdown of PF1 expression phenocopied treatment with Tat-SID both in vitro and in vivo. These results demonstrate a critical role for a complex containing SIN3A and PF1 in TNBC and provide a rational for its therapeutic targeting. Mononucleosomes from MDA-MB-231 cells were isolated and ChIP with H3K4me3 antibody. DNA from Input and ChIP samples was purified and sequenced on Illumina Hiseq.

2015-11-02 | E-GEOD-73869 | biostudies-arrayexpress

sRSM1 synthetic decoy vs. scrambled transfections in MDA-MB-231 cells

Project description:Transcriptional profiling of MDA-MB-231 comparing the regulatory consequences of transfecting synthetic decoys carring sRSM1 motifs versus synthetic scrambled oligos Two decoy/scrambled sets, each with two biological replicates

2012-02-28 | E-GEOD-35749 | biostudies-arrayexpress

SILAC analysis of long bone osteoblasts isolated from Tgif1+/+ and Tgif1-/- mice

Project description:Eric Hesse 9 Jan 2019, 17:34 (15 hours ago) to me, Hartmut Lieber Marcel, unten ist das abstract kopiert, reicht das? Lg, Eric Abstract Osteoporosis is caused by increased bone resorption and decreased bone formation. Intermittent administration of a fragment of Parathyroid hormone (PTH) activates osteoblast-mediated bone formation and is used in patients with severe osteoporosis. However, the mechanisms by which PTH elicits its anabolic effect are not fully elucidated. Here we show that the absence of the homeodomain protein TG-interacting factor 1 (Tgif1) impairs osteoblast differentiation and activity, leading to a reduced bone formation. Deletion of Tgif1 in osteoblasts and osteocytes decreases bone resorption due to an increased secretion of Semaphorin 3E (Sema3E), an osteoclast-inhibiting factor. Tgif1 is a PTH target gene and PTH treatment failed to increase bone formation and bone mass in Tgif1-deficient mice. Thus, our study identifies Tgif1 as a novel regulator of bone remodeling and an essential component of the PTH anabolic action. These insights contribute to a better understanding of bone metabolism and the anabolic function of PTH.

2019-01-29 | PXD012303 | Pride

Expression consequences of decoy vs scrambled oligonucleotides harboring AAAA[AGT]TT motif in MBA-MD-231 cell line

Project description:Dual-color transcriptional profiling of decoy-transfected cells, harboring AAAA[AGT]TT motif, versus scrambled-transfected cells as controls.

2009-11-04 | GSE18844 | GEO

Targeting the SIN3A-PF1 Interaction inhibits Epithelial to Mesenchymal Transition and Maintenance of a Stem Cell Phenotype in Triple Negative Breast Cancer (Expression)

2015-11-02 | GSE73278 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data