Comparative expression profile of microRNAs in Anopheles anthropophagus midgut after blood feeding and Plasmodium infection
Ontology highlight
ABSTRACT:
ORGANISM(S): Anopheles anthropophagus
PROVIDER: GSE93545 | GEO | 2017/01/13
SECONDARY ACCESSION(S): PRJNA361078
REPOSITORIES: GEO
Similar Datasets
Project description:The Anopheles gambiae midgut harbors bacteria that proliferate upon a blood feed. We used microarrays to examine the midgut gene expression response at early stages (3hours) after an artifitial meal containing heat killed bacteria. Anopheles gambiae G3 mosquitoes 5-6 day-old were fed BSA (20% in PBS with fresh 10 mM sodium bicarbonate) with or without heat killed E. coli (equivalent of 2.5 ml of 0.8 OD) . Three pools of 10 mosquito midguts were dissected after 3h and processed for microarray analysis of gene expression.
2010-02-21 | E-GEOD-20204 | biostudies-arrayexpress
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed.
2013-04-02 | GSE26941 | GEO
Project description:The Anopheles gambiae midgut harbors bacteria that proliferate upon a blood feed. We used microarrays to examine the midgut gene expression response at early stages (3hours) after an artifitial meal containing heat killed bacteria.
2010-02-13 | GSE20204 | GEO
Project description:Malaria is caused by Plasmodium parasites, which are transmitted via the bites of infected Anopheline mosquitoes. Midgut invasion is a major bottleneck for Plasmodium development inside the mosquito vectors as a rapidly responding immune system recognizes ookinetes and recruits killing factors from the midgut and surrounding tissues, dramatically reducing the population of invading ookinetes before they can successfully traverse the midgut epithelium. Understanding molecular details of the parasite-vector interactions requires precise measurement of nascent protein synthesis in the mosquito during Plasmodium infection. Current expression profiling primarily monitors alterations in steady-state levels of mRNA, but does not address the equally critical issue of whether the proteins encoded by the mRNAs are actually synthesized. In this study, we used sucrose density gradient centrifugation to isolate actively translating Anopheles gambiae mRNAs based upon their association with polyribosomes (polysomes). The proportion of individual gene transcripts associated with polysomes, which is determined by RNA deep sequencing, reflects mRNA translational status. This approach led to identification of 1017 mosquito transcripts that were primarily regulated at the translational level after ingestion of Plasmodium falciparum-infected blood. Caspar, a negative regulator of the NF-kappaB transcription factor Rel2, appears to be substantially activated at the translational levels during Plasmodium infection. In addition, transcripts of Dcr1, Dcr2 and Drosha, which are involved in small RNA biosynthesis, exhibited enhanced associations with polysomes after P. falciparum challenge. This observation suggests that mosquito microRNAs may play an important role in reactions against Plasmodium invasion. We analyzed both total cellular mRNAs and mRNAs that are associated with polysomes to simultaneously monitor transcriptomes and nascent protein synthesis in the mosquito. This approach provides more accurate information regarding the rate of protein synthesis, and identifies some mosquito factors that might have gone unrecognized because expression of these proteins is regulated mainly at the translational level rather than at the transcriptional level after mosquitoes ingest a Plasmodium-infected blood meal. Midguts from female Anopheles gambiae mosquitoes were dissected at around 24 h after ingestion of P. falciparum-infected blood. Mosquitoes fed on uninfected blood were used as control. A portion of the midguts were used for isolation of total cellular RNA. Extracts of the remaining midguts were fractionated over sucrose density gradients, and fifteen fractions were collected from the top of each gradient. Non-polysomal fractions, as well as polysomal fractions were combined, respectively, to obtain two RNA pools per gradient for three independent experiments. The first, last and the sample between non-polysomal and polysomal, were all discarded to ensure pure pools from each set. A fourth experiment was conducted where the polysomal and non-polysomal samples were not pooled, to be used later for qRT-PCR. The mRNA levels of individual mosquito genes in polysome (PS) fractions, nonpolysome (NP) fractions and unfractionated steady-state (total) RNA were determined using high throughput RNA deep sequencing. Each RNA pool generated 2.1-9.8 million raw read . Signal intensities of transcripts from each PS pool were compared to those of transcripts from a matching NP pool. To quantify the translational status of individual mRNA species, we define the relative PS loading [PL=P/(P+NP)] as the extent of mRNA association with polysomes. PL values were compared between the mosquitoes fed on P. falciparum-infected or -uninfected blood.
2012-09-21 | E-GEOD-38707 | biostudies-arrayexpress
Project description:This study seeks to understand the mechanism of midgut escape and identify candidate genes and potential biochemical pathways involved in the midgut infection of chikungunya virus (CHIKV) in vector mosquito Aedes aegypti. We conducted a comparative transcriptomic analysis of midgut samples of female mosquitoes,after feeding a saline meal (SM) or a protein meal (PM) containing CHIKV. Our results allow the conclusion that midgut-expressed genes not involved in blood or protein digestion can be identified by substituting either a bloodmeal or PM for a SM. In presence of orally acquired CHIKV in midguts of SM fed mosquitoes, the majority of the upregulated DE genes belonged to the categories immune system and catalytic activity. These genes included several serine-type endopeptidases, trypsins, collagenases, and M1 zinc metalloproteases, which potentially could be involved in the midgut escape mechanism of CHIKV. One of the serine metalloproteinase genes, AeLT, was further analyzed showing strong (MMP) collagenase activity in vitro. Our results present a set of candidate genes potentially responsible for overcoming the arbovirus midgut escape barrier (MEB) in Ae. aegypti.
2017-05-17 | GSE95378 | GEO
Project description:The mosquito Anopheles gambiae uses its innate immune system to control bacterial and Plasmodium infection of its midgut tissue. The activation of potent IMD pathway-mediated anti-Plasmodium falciparum defenses is dependent on the presence of the midgut microbiota, which activate this defense system upon parasite infection through a peptidoglycan recognition protein, PGRPLC. We employed transcriptomic and reverse genetic analyses to compare the P. falciparum infection-responsive transcriptomes of septic and aseptic mosquitoes and to determine whether bacteria-independent anti-Plasmodium defenses exist. To examine the impact of P. falciparum infection on the mosquito midgut and carcass transcriptomes in the presence or absence of midgut bacteria, we used A. gambiae whole genome microarrays to compare the mRNA abundance of P. falciparum-infected and -naïve mosquitoes of antibiotic- and non-antibiotic treated cohorts. P. falciparum infection induced changes in the abundance of as many as 2,183 and 2,429 transcripts in whole mosquitoes belonging to a variety of functional groups in aseptic and septic mosquitoes. Ultimately, we were interested in identifying the genes involved in bacteria-independent anti-Plasmodium responses, and therefore we focused on transcripts displaying increased abundance in the parasite-infected aseptic midguts, placing a particular emphasis on those with predicted immune functions. Because of the central role of serine protease cascades in regulating insect immune defenses, we focused the remainder of our analysis on a clip-domain serine protease C2 (CLIPC2, AGAP004317) and a serine protease inhibitor 7 (SRPN7, AGAP007693) that were specifically upregulated in the parasite-infected, aseptic mosquito midgut. We showed that SRPN7 negatively and CLIPC2 positively regulate the anti-Plasmodium defense, independently of the midgut-associated bacteria. Co-silencing assays suggested that these two genes may function together in a signaling cascade. Neither gene was regulated, nor modulated, by infection with the rodent malaria parasite Plasmodium berghei, suggesting that SRPN7 and CLIPC2 are components of a defense system with preferential activity towards P. falciparum. Further analysis using RNA interference determined that these genes do not regulate the anti-Plasmodium defense mediated by the IMD pathway, and both factors act as agonists of the endogenous midgut microbiota, further demonstrating the lack of functional relatedness between these genes and the bacteria-dependent activation of the IMD pathway. This is the first study confirming the existence of a bacteria-independent, anti-P. falciparum defense. Aseptic and septic midguts and carcasses from P. falciparum-infected A. gambiae vs aseptic and septic midguts and carcasses from uninfected, blood-fed A. gambiae. 3 biological replicates and 1 pseudo-replicate per each array.
2013-08-10 | E-GEOD-49690 | biostudies-arrayexpress
Project description:We characterize the epigenome of the human malaria vector Anopheles gambiae in midgut cells by mapping the distribution and levels of two post-translational histone modifications, H3K27ac and H3K27me3. These histone profiles were then correlated with levels of gene expression obtained by RNA-seq. ChIP-seq and RNA-seq were performed on adult female A. gambiae midguts. RNA-seq was performed on adult female A. gambiae salivary glands.
2014-09-04 | E-GEOD-59773 | biostudies-arrayexpress
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.
2013-04-02 | E-GEOD-26941 | biostudies-arrayexpress
Project description:Plasmodium parasites within mosquitoes are exposed to various physiological processes, such as blood meal digestion activity, the gonotrophic cycle, and host responses preventing the entry of parasites into the midgut wall. However, when in vitro-cultured ookinetes are injected into the hemocoel of mosquitoes, Plasmodium parasites are not affected by the vertebrate host’s blood contents and do not pass through the midgut epithelial cells. This infection method might aid in identifying mosquito-derived factors affecting Plasmodium development within mosquitoes. This study investigated novel mosquito-derived molecules related to parasite development in Anopheles mosquitoes. We injected in vitro-cultured Plasmodium berghei (ANKA strain) ookinetes into female and male Anopheles stephensi (STE2 strain) mosquitoes and found that the oocyst number was significantly higher in males than in females, suggesting that male mosquitoes better support the development of parasites. Next, RNA-seq analysis was performed on the injected female and male mosquitoes to identify genes exhibiting changes in expression. Five genes with different expression patterns between sexes and greatest expression changes were identified as being potentially associated with Plasmodium infection. Two of the five genes also showed expression changes with infection by blood-feeding, indicating that these genes could affect the development of Plasmodium parasites in mosquitoes.
2024-05-06 | GSE197159 | GEO
Project description:Anopheles darlingi transcriptome in response to Plasmodium vivax invasion of midgut
2025-05-01 | GSE122914 | GEO