Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Identification of a Novel SYK/c-MYC/MALAT1 Signaling Pathway and Its Potential Therapeutic Value in Ewing Sarcoma

ABSTRACT: Ewing Sarcoma (EWS) is a devastating soft tissue sarcoma affecting predominantly young individuals. Tyrosine kinases (TKs) and associated pathways are continuously activated in many malignancies including EWS; these enzymes provide candidate therapeutic targets. Using two high-throughput screens with EWS cell lines (a siRNA library and a small-molecule inhibitor library of that predominantly target the TK family), we identified spleen tyrosine kinase (SYK) as a candidate actionable target. SYK is highly phosphorylated in the majority of EWS cells, and SYK inhibition by a variety of genetic and pharmacological approaches markedly inhibited EWS cells both in vitro and in vivo. Ectopic expression of SYK rescued the cytotoxicity triggered by SYK-depletion associated with the reactivation of AKT and c-MYC. Transcriptome analysis identified that a Long non-coding RNA, metastasis associated lung adenocarcinoma transcript 1 (MALAT1), was dependent on by SYK-mediated signaling. Moreover, c-MYC, a SYK up-regulated gene, bound to the promoter region of MALAT1 and transcriptional activated MALAT1, which further promoted the proliferation of EWS cells. Taken together, the present study identifies a novel signaling involving SYK/c-MYC/MALAT1 as a promising therapeutic target for the treatment of EWS.

ORGANISM(S): Homo sapiens

PROVIDER: GSE93677 | GEO | 2017/01/17

SECONDARY ACCESSION(S): PRJNA361521

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Similar Datasets

SYK Is a Critical Regulator of FLT3 In Acute Myeloid Leukemia

Project description:Cooperative dependencies between mutant oncoproteins and wild-type proteins are critical in cancer pathogenesis and therapy resistance. Although spleen tyrosine kinase (SYK) has been implicated in hematologic malignancies, it is rarely mutated. We used kinase activity profiling to identify collaborators of SYK in acute myeloid leukemia (AML) and determined that FMS-like tyrosine kinase 3 (FLT3) is transactivated by SYK via direct binding. Highly activated SYK is predominantly found in FLT3-ITD positive AML and cooperates with FLT3-ITD to activate MYC transcriptional programs. FLT3-ITD AML cells are more vulnerable to SYK suppression than FLT3 wild-type counterparts. In a FLT3-ITD in vivo model, SYK is indispensable for myeloproliferative disease (MPD) development, and SYK overexpression promotes overt transformation to AML and resistance to FLT3-ITD-targeted therapy. HL-60, MOLM-14, and U937 cell lines were transduced in triplicate with a control luciferase-directed shRNA (target sequence CCTAAGGTTAAGTCGCCCTCG), and in duplicate with two SYK-directed shRNAs: shSYK_1 (clone ID TRCN0000197257, target sequence GCAGCAGAACAGACATGTCAA) and shSYK_2 (clone ID TRCN0000003163 , target sequence GCAGGCCATCATCAGTCAGAA), and were then selected with 1 Âµg/ml puromycin 48 hours post-infection. At day 5 post-infection, RNA was extracted and profiled using HT HG-U133A arrays (Affymetrix) at the Broad Institute (Cambridge, MA, USA). The computational analysis of the gene expression data was performed through the Genome Space bioinformatics platform (http://www.genomespace.org).

2014-01-15 | E-GEOD-54065 | biostudies-arrayexpress

SYK Is a Critical Regulator of FLT3 In Acute Myeloid Leukemia

2014-01-15 | GSE54065 | GEO

RUNX3 Facilitates Growth of Ewing Sarcoma Cells

Project description:Ewing sarcoma is an aggressive pediatric small round cell tumor that predominantly occurs in bone. Approximately 85% of Ewing sarcomas harbor the EWS/FLI fusion protein, which arises from a chromosomal translocation, t(11:22)(q24:q12). EWS/FLI interacts with numerous lineage-essential transcription factors to maintain mesenchymal progenitors in an undifferentiated state. We previously showed that EWS/FLI binds the osteogenic transcription factor RUNX2 and prevents osteoblast differentiation. In this study, we investigated the role of another Runt-domain protein, RUNX3, in Ewing sarcoma. RUNX3 participates in mesenchymal-derived bone formation and is a context dependent tumor suppressor and oncogene. RUNX3 was detected in all Ewing sarcoma cells examined, whereas RUNX2 was detected in only 73% of specimens. Like RUNX2, RUNX3 binds to EWS/FLI via its Runt domain. EWS/FLI prevented RUNX3 from activating the transcription of a RUNX-responsive reporter, p6OSE2. Stable suppression of RUNX3 expression in the Ewing sarcoma cell line A673 delayed colony growth in anchorage independent soft agar assays and reversed expression of EWS/FLI-responsive genes. These results demonstrate an important role for RUNX3 in Ewing sarcoma. RNA-seq to compare transcriptiome of control A673 ewing sarcoma cells stably expression a non-target or RUNX3 shRNA

2014-05-01 | E-GEOD-56900 | biostudies-arrayexpress

RNA-Seq in two Ewing sarcoma cell lines: A673 and SKNMC

Project description:As the second most common malignant bone tumor in children and adolescents, Ewing sarcoma is initiated and exacerbated by a chimeric oncoprotein, most commonly, EWS-FLI1. In this study, we apply epigenomic analysis to characterize the transcription dysregulation in this cancer, focusing on the investigation of super-enhancer and its associated transcriptional regulatory mechanisms. We demonstrate that super-enhancer-associated transcripts are significantly enriched in EWS-FLI1 target genes, contribute to the aberrant transcriptional network of the disease, and mediate the exceptional sensitivity of Ewing sarcoma to transcriptional inhibition. Through integrative analysis, we identify MEIS1 as a super-enhancer-driven oncogene, which co-operates with EWS-FLI1 in transcriptional regulation, and plays a key pro-survival role in Ewing sarcoma. Moreover, APCDD1, another super-enhancer-associated gene, acting as a downstream target of both MEIS1 and EWS-FLI1, is also characterized as a novel tumor-promoting factor in this malignancy. These data delineate super-enhancer-mediated transcriptional deregulation in Ewing sarcoma, and uncover numerous candidate oncogenes which can be exploited for further understanding of the molecular pathogenesis for this disease.

2018-12-04 | GSE117485 | GEO

Genome-wide chromatin analysis of Ewing sarcoma (ChIP-seq)

2018-12-04 | GSE109477 | GEO

USP1 expression driven by EWS-FLI1 transcription factor stabilizes Survivin and promotes Ewing sarcoma cell survival

Project description:Ewing sarcoma (EWS) is a malignant pediatric bone cancer. Most Ewing sarcomas are driven by EWS-FLI1 oncogenic transcription factor that plays roles in transcriptional regulation, DNA damage response, cell cycle checkpoint control, and alternative splicing. USP1, a deubiquitylase which regulates DNA damage and replication stress responses, is overexpressed at both the mRNA and protein levels in EWS cell lines compared to human mesenchymal stem cells, the EWS cell of origin. The functional significance of high USP1 expression in Ewing sarcoma is not known. Here, we identify USP1 as a transcriptional target of EWS-FLI1 and a key regulator of EWS cell survival. We show that EWS-FLI1 knockdown decreases USP1 mRNA and protein levels. ChIP and ChIP-seq analyses show EWS-FLI1 occupancy on the USP1 promoter. Importantly, USP1 knockdown or inhibition arrests EWS cell growth and induces cell death by apoptosis. We observe destabilization of Survivin (also known as BIRC5 or IAP4) and activation of caspases-3 and -7 following USP1 knockdown or inhibition in the absence of external DNA damage stimuli. Notably, EWS cells display hypersensitivity to combinatorial treatment of doxorubicin or etoposide, EWS standard of care drugs, and USP1 inhibitor compared to single agents alone. Together, our study demonstrates that USP1 is regulated by EWS-FLI1, the USP1-Survivin axis promotes EWS cell survival, and USP1 inhibition sensitizes EWS cells to standard of care chemotherapy.

2024-01-26 | PXD041033 | Pride

High-throughput RNAi cell viability screen to identify selective targets for EWS-FLI1 positive Ewing sarcoma

Project description:We have performed a high-throughput RNA interference screen to identify targets inhibiting EWS-FLI1 driven cell proliferation in Ewing sarcoma cells. EWS-FLI1 expressing A673 Ewing sarcoma cells were screened both in presence and absence of EWS-FLI1 shRNA induction with druggable siRNA library. Leucine rich repeats and WD repeat Domain containing 1 (LRWD1) targeting siRNA pool was the strongest anti-proliferative hit identified only in presence of EWS-FLI1. Validation experiments confirmed the anti-proliferative effect of LRWD1 depletion especially in EWS-FLI1 expressing cells. Functional analysis of differentially expressed genes in LRWD1 depleted Ewing sarcoma cells showed over-representation of connective tissue development, cell projection morphogenesis and neuronal processes.

2018-09-16 | GSE73092 | GEO

Transcription profiling of human Ewing sarcoma (A673) cells treated with cytarabine, doxorubicin and puromycin oral tongue squamous cell carcinomas to identify novel potential prognosticators

Project description:An increasing number of cancer-associated mutations have been identified. Unfortunately, little therapy today exploits these tumor-specific genetic lesions. Often, the resulting oncoproteins have been intractable to easy manipulation with current small molecule screening approaches. To overcome this impasse, we developed an expression-based approach to small molecule library screening. We applied this platform to the discovery of modulators of the activity of EWS/FLI, the Ewing sarcoma associated oncoprotein. Cytarabine (ARA-C) was identified as the top hit in a small molecule library screen. ARA-C modulates EWS/FLI by decreasing EWS/FLI protein level and has striking effects on cellular viability and transformation in in vitro and in vivo models of Ewing sarcoma. With poor outcomes for patients with relapsed Ewing sarcoma and the well established safety profile of ARA-C, clinical trials testing ARA-C in Ewing sarcoma are warranted. Expression data was created for A673 cells treated with ARA-C and two other compounds used to treat Ewing sarcoma (Puromycin and Doxorubicin) at two doses (EC50 and 2xEC50) and three time points (24 hours, 3 days, and 5 days). Experiment Overall Design: A673 cells were treated with ARA-C (at doses of EC50 and 2xEC50) or vehicle in triplicate and expression profiled at 24 hours, 3 days, and 5 days. To exclude the possibility that ARA-C's modulation of the EWS/FLI signature was simply a non-specific response to treatment with all cytotoxic agents, we asked whether other compounds known to kill Ewing sarcoma cells (Doxorubicin and Puromycin) would induce the EWS/FLI off genome-wide expression pattern. A673 cells were treated with Doxorubicin and Puromycin (at doses of EC50 and 2xEC50) and expression profiled at 24 hours, 3 days, and 5 days.

2008-11-22 | E-GEOD-6930 | biostudies-arrayexpress

Expression data for analysis of genes regulated by EWS/FLI1 protein levels in Ewing sarcoma cell line A673

Project description:Comparison of gene expression profile of Ewing sarcoma cells which have an exchange of the endogenous EWS/FLI1 to either wild-type or a turnover-deficient mutant EWS/FLI1. Most target genes are saturated as only a few target genes are soly driven by increasing protein amount. The effect of a stable EWS/FLI1 mutant on global gene expression was evaluated in A673 Ewing sarcoma cells.

2016-11-16 | GSE81018 | GEO

RUNX3 Facilitates Growth of Ewing Sarcoma Cells

2014-05-01 | GSE56900 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data