Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Innate Immune Response and Off-Target Mis-splicing Are Common Morpholino-Induced Side Effects in Xenopus

ABSTRACT: We report on the implications of genetic KO versus MO-mediated KD of the mesoderm-specifying Brachyury paralogues in the Western clawed frog Xenopus tropicalis. While both KO and KD embryos fail to activate the same core gene regulatory network, resulting in virtually identical morphological defects, embryos injected with control or target MOs also show a systemic GC content dependent immune response and many off-target splicing defects.

ORGANISM(S): Xenopus tropicalis

PROVIDER: GSE96655 | GEO | 2018/02/21

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Innate Immune Response and Off-Target Mis-splicing Are Common Morpholino-Induced Side Effects in Xenopus.

Project description:Antisense morpholino oligomers (MOs) have been indispensable tools for developmental biologists to transiently knock down (KD) genes rather than to knock them out (KO). Here we report on the implications of genetic KO versus MO-mediated KD of the mesoderm-specifying Brachyury paralogs in the frog Xenopus tropicalis. While both KO and KD embryos fail to activate the same core gene regulatory network, resulting in virtually identical morphological defects, embryos injected with control or target MOs also show a systemic GC content-dependent immune response and many off-target splicing defects. Optimization of MO dosage and increasing incubation temperatures can mitigate, but not eliminate, these MO side effects, which are consistent with the high affinity measured between MO and off-target sequence in vitro. We conclude that while MOs can be useful to profile loss-of-function phenotypes at a molecular level, careful attention must be paid to their immunogenic and off-target side effects.

| S-EPMC5861998 | biostudies-literature

Identification of differentially-expressed genes between FoxH1 morpholino and control in zebrafish embryos.

Project description:The Forkhead Box H1 (FoxH1) protein is a co-transcription factor recruited by phosphorylated Smad2 downstream of several TGFbetas, including Nodal-related proteins. We have reassessed the function of zebrafish FoxH1 using antisense morpholino oligonucleotides (MOs) ( 5’ TGCTTTGTCATGCTGATGTAGTGGG 3’) as compared with a control morpholino (MO) with no specific target (5’ TAGTTAAGCCTAGCTCTCATAAACT 3’). Probing FoxH1 morphant RNA by microarray, we identified a cohort of five keratin genes – cyt1, cyt2, krt4, krt8 and krt18 - that are normally transcribed in the embryo’s enveloping layer (EVL) and which have significantly reduced expression in FoxH1-depleted embryos. Keywords: 40% epiboly-stage embryos, injected with either 8 ng of a 25mer morpholino (MO) with no specific target or 8 ng of a 25mer MO with reverse complementary to the 5’ untranslated region of the zebrafish foxH1 gene.

2007-07-30 | GSE8076 | GEO

Nucleolus assembly impairment leads to two-cell transcriptional repression via NPM1-mediated PRC2 recruitment

Project description:We report the high-throughput sequencing of RNA expression in control embryos ,LoNA KO embryos, control 2c like mESC and LoNA KD 2c like mESC

2023-03-31 | GSE166142 | GEO

Expression data from embryos injected with DrC1q-like morpholino and control morpholino

2007-12-29 | GSE8800 | GEO

Transcription profiling of zebrafish embryos injected with DrC1q-like morpholino and control morpholino

Project description:Except complement C1q, the immunological functions of other C1q family members have remained unclear. In vitro studies showed that DrC1q-like could inhibit the apoptosis induced by ActD and CHX in EPC cells, through repressing the activation of caspase 3/9. Moreover, its physiological roles were studied by morpholino-mediated knockdown in zebrafish embryogenesis; We used microarrays to compare the global programme of gene expression of DrC1q-like deficient embryos and control embryos. And identified distinct classes of up-regulated and down-regulated genes in DrC1q-like deficient embryos. Experiment Overall Design: Zebrafish embryos were selected at 24hpf for RNA extraction and hybridization on Affymetrix microarrays. We sought to obtain expression profiles of DrC1q-like deficient embryos compared to the control. And we could find out which genes and pathways were affected by DrC1q-like

2008-06-16 | E-GEOD-8800 | biostudies-arrayexpress

RNA-seq of HNRNPAB morpholino in zebrafish

Project description:To investigate the transcriptomic alterations following 24hpf knockdown of the gene HNRNPAB in zebrafish, we injected HNRNPAB morpholino with 3ng and 6ng into 1-cell zebrafish embryos separately, and the 24hpf embryos were collected for RNA-seq.

2022-03-31 | GSE199586 | GEO

Bipartite histone H3 recognition by the PZP domain of PHF14 facilitates zygotic genome activation in zebrafish

Project description:Standard and Phf14 MOs were injected into 1-cell stage embryos and when developed into sphere stage (4.7 hpf), embryos were lysed for mRNA extraction for high-through put sequencing based on BGISEQ, in order to compare gene expression test at the whole genome level.

2021-06-01 | GSE159087 | GEO

Dysregulation of gene expression during gastrulation results in impaired primitive erythropoiesis and vascular development in Trim71-KO embryos

Project description:During embryonic development in mice, global deficiency of Trim71 (Trim71-KO) leads to defects in vascular development of the yolk sac and impaired primitive erythropoiesis. These phenotypes start to become apparent at E9.5. We analyzed changes in gene expression by single-cell RNA-sequencing (scRNA-seq) in whole Trim71-KO embryos compared to wildtype embryos at an early developmental stage (E7.5, late gastrulation) to investigate the onset of these phenotypes. Furthermore, we analyzed Trim71-KO and wildtype yolk sacs at E9.5 by scRNA-seq to gain insight into the changes in gene expression at the developmental stage when vascular defects have become apparent.

2025-02-04 | GSE272044 | GEO

Xenopus laevis embryos and animal caps: Control vs PouV morpholino

Project description:Transcriptional profiling of Xenopus laevis embryos and ectoderm (animal caps) comparing embryos injected with control morpholino with embryos injected with the morpholino mixture PVD2, which knocks down all three Xenopus PouV proteins. Whole embryos (WE) or animal caps (AC) were collected at late blastula (9) or early gastrula (10) stages from Control and PVD2 morphants.

2013-11-12 | GSE47578 | GEO

Tbx5 paralogues during zebrafish development

Project description:Purpose: The goals of this study were to compare the effect on the transcriptome of loss of the Tbx5 paralogues in zebrafish. Methods: Whole embryos were injected with morpholinos targetting either Tbx5a, Tbx5b, or both at the single cell stage. At either 18 or 21 hpf, embryos were pooled and RNA was extracted from the whole embryo. Transcriptomes were generated using Illumina HiSeq 2500. Results: The preliminary experiment produced 632 million reads and a list of 494 differentially expressed genes (detected using Cuffdiff), of which 454 were unique. This final triplicate sequencing gave 309.4 million reads. When using Cuffdiff to produce differential gene expression lists, a list of 162 differentially expressed genes were identified. Conclusions: This study is a detailed analysis of the different transcriptomes of zebrafish deficient in the Tbx5 paralogues and the differential gene expression that occurs as a result of downregulation of the paralogues, both individually and separately.

2018-06-12 | GSE115640 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data