Innate Immune Response and Off-Target Mis-splicing Are Common Morpholino-Induced Side Effects in Xenopus
Ontology highlight
ABSTRACT:
ORGANISM(S): Xenopus tropicalis
PROVIDER: GSE96655 | GEO | 2018/02/21
REPOSITORIES: GEO
Similar Datasets
Project description:In this work, we developed a microprobe capillary electrophoresis high-resolution mass spectrometry approach to identify proteins in single identified cells in live embryos of the South African clawed frog (Xenopus laevis) and also zebrafish. We used a pulled borosilicate capillary to aspirate a calibrated portion of the cell of interest. Proteins in the collected aspirate were detected and quantified via a bottom-up proteomic workflow that was downscaled to the single cells. The microprobe mass spectrometry platform is scalable to smaller cells in live, morphologically complex, developing embryos. As an example, we used this approach to analyze proteomic changes in cells that form a clone in the early developing Xenopus laevis embryo.
2020-05-26 | PXD006905 | Pride
Project description:The vertebrate body plan is established through inductive signaling during gastrulation via a signaling center, which is called the Spemann-Mangold organizer (SMO) in the developmental model Xenopus laevis, the South African Clawed Frog. Here, we performed a multiplexed quantitative proteomic screen of the SMO in contrast with the rest of the embryo (RE). Wild-type embryos were cultured to the 32-cell stage, where precursor cells of the SMO were injected with a fluorescent lineage tracing dye. These experimental embryos were cultured to stage 10 (beginning of gastrulation), whence the fluorescently labelled cells were dissected. The proteome of the SMO and the RE were quantified using multiplexing quantification. The tissue samples were processed using a bottom-up proteomic workflow and analyzed using LC-MS3. The resulting data revealed an upregulation of oxidative phosphorylation (OXPHOS) in the SMO tissues.
2024-01-10 | PXD043583 | Pride
Project description:The Forkhead Box H1 (FoxH1) protein is a co-transcription factor recruited by phosphorylated Smad2 downstream of several TGFbetas, including Nodal-related proteins. We have reassessed the function of zebrafish FoxH1 using antisense morpholino oligonucleotides (MOs) ( 5’ TGCTTTGTCATGCTGATGTAGTGGG 3’) as compared with a control morpholino (MO) with no specific target (5’ TAGTTAAGCCTAGCTCTCATAAACT 3’). Probing FoxH1 morphant RNA by microarray, we identified a cohort of five keratin genes – cyt1, cyt2, krt4, krt8 and krt18 - that are normally transcribed in the embryo’s enveloping layer (EVL) and which have significantly reduced expression in FoxH1-depleted embryos. Keywords: 40% epiboly-stage embryos, injected with either 8 ng of a 25mer morpholino (MO) with no specific target or 8 ng of a 25mer MO with reverse complementary to the 5’ untranslated region of the zebrafish foxH1 gene.
2007-07-30 | GSE8076 | GEO
Project description:We report the high-throughput sequencing of RNA expression in control embryos ,LoNA KO embryos, control 2c like mESC and LoNA KD 2c like mESC
2023-03-31 | GSE166142 | GEO
Project description:Congo dwarf clawed frog is related to clawed frogs of the genus Xenopus
| PRJNA68371 | ENA
Project description:Merlin's clawed frog is distantly related to clawed frogs in the genus Xenopus
| PRJNA68375 | ENA
Project description:Frog virus 3 (FV3) and other ranaviruses are responsible for an increasing number of die-offs involving wild, farmed, and captive amphibians, fish, and reptiles. Studies in Lithobates pipiens (Leopard frogs) and Xenopus laevis (African clawed frog) indicate that embryos and tadpoles are more likely to succumb to FV3 infection than adult animals. The heightened susceptibility of embryos and tadpoles to ranaviral disease likely reflects the immaturity of their immune system. To ascertain which elements of the immune system respond to ranavirus infection, we explored cellular transcriptional responses following infection of fathead minnow (Pimephales promelas) cells with either wild type (wt) FV3 or a knock out (KO) mutant targeting the 18kDa immediate early gene (18K). At 8 hr post infection (p.i.), a time when late viral gene expression has begun and host protein synthesis has been inhibited, we observed marked up-regulation of multiple cellular transcripts encoding proteins affecting innate and acquired immune responses. We found 2367 target sequences expressed 4-fold or higher in wt-infected cells versus 530 target sequences that were 4-fold or more downregulated. For example, in cells infected with wt virus, interferon (IFN) transcripts were elevated compared to mock-infected cells, along with those encoding IFN regulatory factors (IRFs), IFN stimulated genes (ISGs) such as Mx and MHC class I, and other immune related gene products such as the interleukins IL-1M-NM-2, IL-8, IL-17C and IL-12. Cells infected with the 18K KO mutant (M-bM-^HM-^F18K) showed generally similar levels of induction although quantitative and qualitative differences were noted. Collectively, these results indicate that ranavirus infection induced expression of multiple cellular genes affecting both innate and acquired immunity. It is likely that induction of various immune-related genes may slow or limit viral infection through the activation of multiple components of the innate immune system and, in a whole animal, enhance the development of acquired immunity and protect from disease. To ascertain which elements of the immune system respond to ranavirus infection, we explored cellular transcriptional responses following infection of fathead minnow (Pimephales promelas) cells with either wild type (wt) FV3 or a knock out (KO) mutant targeting the 18kDa immediate early gene (18K). Replicate confluent monolayers of FHM cells grown on 35 mm dishes were mock-infected or infected with wt- or M-bM-^HM-^F18K-FV3 at a MOI of 10 PFU/cell. At 8 hr p.i., total RNA was isolated from samples RNeasy (Qiagen, Valencia, CA, USA) for microarray analysis. Five or six replicates were used per treatment.
2014-06-01 | E-GEOD-53739 | biostudies-arrayexpress
Project description:Frog virus 3 (FV3) and other ranaviruses are responsible for an increasing number of die-offs involving wild, farmed, and captive amphibians, fish, and reptiles. Studies in Lithobates pipiens (Leopard frogs) and Xenopus laevis (African clawed frog) indicate that embryos and tadpoles are more likely to succumb to FV3 infection than adult animals. The heightened susceptibility of embryos and tadpoles to ranaviral disease likely reflects the immaturity of their immune system. To ascertain which elements of the immune system respond to ranavirus infection, we explored cellular transcriptional responses following infection of fathead minnow (Pimephales promelas) cells with either wild type (wt) FV3 or a knock out (KO) mutant targeting the 18kDa immediate early gene (18K). At 8 hr post infection (p.i.), a time when late viral gene expression has begun and host protein synthesis has been inhibited, we observed marked up-regulation of multiple cellular transcripts encoding proteins affecting innate and acquired immune responses. We found 2367 target sequences expressed 4-fold or higher in wt-infected cells versus 530 target sequences that were 4-fold or more downregulated. For example, in cells infected with wt virus, interferon (IFN) transcripts were elevated compared to mock-infected cells, along with those encoding IFN regulatory factors (IRFs), IFN stimulated genes (ISGs) such as Mx and MHC class I, and other immune related gene products such as the interleukins IL-1β, IL-8, IL-17C and IL-12. Cells infected with the 18K KO mutant (∆18K) showed generally similar levels of induction although quantitative and qualitative differences were noted. Collectively, these results indicate that ranavirus infection induced expression of multiple cellular genes affecting both innate and acquired immunity. It is likely that induction of various immune-related genes may slow or limit viral infection through the activation of multiple components of the innate immune system and, in a whole animal, enhance the development of acquired immunity and protect from disease.
2014-06-01 | GSE53739 | GEO
Project description:Except complement C1q, the immunological functions of other C1q family members have remained unclear. In vitro studies showed that DrC1q-like could inhibit the apoptosis induced by ActD and CHX in EPC cells, through repressing the activation of caspase 3/9. Moreover, its physiological roles were studied by morpholino-mediated knockdown in zebrafish embryogenesis We used microarrays to compare the global programme of gene expression of DrC1q-like deficient embryos and control embryos. And identified distinct classes of up-regulated and down-regulated genes in DrC1q-like deficient embryos. Keywords: time course
2007-12-29 | GSE8800 | GEO
Project description:Frogs are an ecologically diverse and phylogenetically ancient group of anuran amphibians that include important vertebrate cell and developmental model systems, notably the genus Xenopus. Here we report a high-quality reference genome sequence for the western clawed frog, Xenopus tropicalis, along with draft chromosome-scale sequences of three distantly related emerging model frog species, Eleutherodactylus coqui, Engystomops pustulosus and Hymenochirus boettgeri. Frog chromosomes have remained remarkably stable since the Mesozoic Era, with limited Robertsonian (i.e., centric) translocations and end-to-end fusions found among the smaller chromosomes. Conservation of synteny includes conservation of centromere locations, marked by centromeric tandem repeats associated with Cenp-a binding, surrounded by pericentromeric LINE/L1 elements. We explored chromosome structure across frogs, using a dense meiotic linkage map for X. tropicalis and chromatin conformation capture (Hi-C) data for all species. Abundant satellite repeats occupy the unusually long (~20 megabase) terminal regions of each chromosome that coincide with high rates of recombination. Both embryonic and differentiated cells show reproducible association of centromeric chromatin, and of telomeres, reflecting a Rabl-like configuration. Our comparative analyses reveal 13 conserved ancestral anuran chromosomes from which contemporary frog genomes were constructed.
2022-03-30 | GSE199671 | GEO