Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Natural RNA polymerase aptamers regulate transcription in E. coli [3' RACE]

ABSTRACT: In search for RNA signals that modulate transcription via direct interaction with RNA polymerase (RNAP) we deep-sequenced an E. coli genomic library enriched for RNAP-binding RNAs. Many natural RNAP-binding aptamers, termed RAPs, were mapped to the genome. Over 60% of E. coli genes carry RAPs in their mRNA. Combining in vitro and in vivo approaches we characterized a subset of RAPs (iRAPs) that promote Rho-dependent transcription termination. A representative iRAP within the coding region of the essential gene, nadD, greatly reduces its transcriptional output in stationary phase and under oxidative stress, demonstrating that iRAPs control gene expression in response to changing growth conditions. The mechanism of iRAPs involves active uncoupling of transcription and translation, making the nascent RNA accessible to Rho. iRAPs encoded in the antisense strand also promote gene expression by reducing transcriptional interference. In essence, our work uncovers a broad class of cis-acting RNA signals that globally control bacterial transcription.

ORGANISM(S): Escherichia coli

PROVIDER: GSE98660 | GEO | 2017/06/01

SECONDARY ACCESSION(S): PRJNA385826

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Similar Datasets

Natural RNA polymerase aptamers regulate transcription in E. coli [SELEX]

Project description:In search for RNA signals that modulate transcription via direct interaction with RNA polymerase (RNAP) we deep-sequenced an E. coli genomic library enriched for RNAP-binding RNAs. Many natural RNAP-binding aptamers, termed RAPs, were mapped to the genome. Over 60% of E. coli genes carry RAPs in their mRNA. Combining in vitro and in vivo approaches we characterized a subset of RAPs (iRAPs) that promote Rho-dependent transcription termination. A representative iRAP within the coding region of the essential gene, nadD, greatly reduces its transcriptional output in stationary phase and under oxidative stress, demonstrating that iRAPs control gene expression in response to changing growth conditions. The mechanism of iRAPs involves active uncoupling of transcription and translation, making the nascent RNA accessible to Rho. iRAPs encoded in the antisense strand also promote gene expression by reducing transcriptional interference. In essence, our work uncovers a broad class of cis-acting RNA signals that globally control bacterial transcription.

2017-06-01 | GSE98659 | GEO

Rho directs widespread termination of intragenic and stable RNA transcription

Project description:The transcription termination factor Rho is a global regulator of RNA polymerase (RNAP). Although individual Rho-dependent terminators have been studied extensively, less is known about the sites of RNAP regulation by Rho on a genome-wide scale. Using chromatin immunoprecipitation and microarrays (ChIP-chip), we examined changes in the distribution of Escherichia coli RNAP in response to the Rho-specific inhibitor bicyclomycin (BCM). We found ~200 Rho-terminated loci that were divided evenly into two classes: intergenic (at the ends of genes) and intragenic (within genes). The intergenic class contained noncoding RNAs such as small RNAs (sRNAs) and transfer RNAs (tRNAs), establishing a previously unappreciated role of Rho in termination of stable RNA synthesis. The intragenic class of terminators included a novel set of short antisense transcripts, as judged by a shift in the distribution of RNAP in BCM-treated cells that was opposite to the direction of the corresponding gene. These Rho-terminated antisense transcripts point to a novel role of noncoding transcription in E. coli gene regulation that may resemble the ubiquitous noncoding transcription recently found to play myriad roles in eukaryotic gene regulation.

2009-06-23 | GSE16562 | GEO

Regulator trafficking on bacterial transcription units in vivo

Project description:The in vivo trafficking patterns on DNA by the bacterial regulators of transcript elongation Sigma70, Rho, NusA, and NusG and the explanation for high promoter-proximal levels or peaks of RNA polymerase (RNAP) are unknown. Genome-wide ChIP-chip on E. coli revealed distinct association patterns of regulators as RNAP transcribes away from promoters (Rho first, then NusA, and then NusG). However, the interactions of elongating complexes with these regulators, including a weak interaction with Sigma70, did not differ significantly among most transcription units. A modest variation of NusG signal among genes reflected increased NusG interaction as transcription progresses, rather than functional specialization of elongating complexes. Promoter-proximal RNAP peaks were offset from Sigma70 peaks in the direction of transcription and co-occurred with NusA and Rho peaks, suggesting that the RNAP peaks reflected elongating, rather than initiating, complexes. However, inhibition of Rho did not increase RNAP levels within genes downstream of the RNAP peaks, suggesting the peaks are caused by a mechanism other than simple Rho-dependent attenuation. Chromatin immunoprecipitation (ChIP) experiments were performed using antibodies against RNA polymerase (Beta' subunit), Sigma70, NusA, NusG, or Rho. Differentially labeled ChIP DNA and genomic DNA were competitively hybridized to an E. coli K-12 MG1655 tiling array with overlapping probes at ~24bp spacing across the entire genome. The series contains 17 total datasets.

2010-05-14 | E-GEOD-13938 | biostudies-arrayexpress

Rho directs widespread termination of intragenic and stable RNA transcription

2010-05-18 | E-GEOD-16562 | biostudies-arrayexpress

Regulator trafficking on bacterial transcription units in vivo

2009-01-03 | GSE13938 | GEO

Natural RNA polymerase aptamers regulate transcription in E. coli

Project description:Natural RNA polymerase aptamers regulate transcription in E. coli

| PRJNA385824 | ENA

Facile Discovery of Cell-surface Protein Targets of Cancer Cell Aptamers

Project description:Cancer biomarker discovery constitutes a frontier in cancer research. In recent years, cell-binding aptamers have become useful molecular probes for biomarker discovery. However, there are few successful examples, and the critical barrier resides in the identification of the cell-surface protein targets for the aptamers, where only a limited number of aptamer targets have been identified so far. Herein, we developed a universal SILAC-based quantitative proteomic method for target discovery of cell-binding aptamers. The method allowed for distinguishing specific aptamer-binding proteins from non-specific proteins based on abundance ratios of proteins bound to aptamer-carrying bait and control bait. In addition, we employed fluorescently labeled aptamers for monitoring and optimizing the binding conditions. We were able to identify and validate selectin L and integrin 4 as the protein targets for two previously reported aptamers, Sgc-3b and Sgc-4e, respectively. This strategy should be generally applicable for the discovery of protein targets for other cell-binding aptamers, which will promote the applications of these aptamers.

2022-02-28 | PXD002480 | Pride

Rho and NusG suppress pervasive antisense transcription in Escherichia coli [ChIP-chip].

Project description:Despite the prevalence of antisense transcripts in bacterial transcriptomes, little is known about how their synthesis is controlled. We report that a major function of the Escherichia coli termination factor Rho and its co-factor NusG is suppression of ubiquitous antisense transcription genome-wide. Rho binds C-rich unstructured nascent RNA (high C/G ratio) prior to its ATP-dependent dissociation of transcription complexes. NusG is required for efficient termination at minority subsets (~20%) of both antisense and sense Rho-dependent terminators with lower C/G ratio sequences. In contrast, a widely studied nusA deletion proposed to compromise Rho-dependent termination had no effect on antisense or sense Rho-dependent terminators in vivo. Global co-localization of the nucleoid-associated protein H-NS with Rho-dependent terminators and genetic interactions between hns and rho suggest that H-NS aids Rho in suppression of antisense transcription. The combined actions of Rho, NusG, and H-NS appear to be analogous to the Sen1-Nrd1-Nab3 and nucleosome systems that suppress antisense transcription in eukaryotes. Chromatin immunoprecipitation (ChIP) experiments were performed using antibodies against RNA polymerase (RNAP; Beta subunit) in wild-type cells or cells deleted for hns, nusG, or a partial deletion of nusA. Differentially labeled ChIP DNA and genomic DNA were competitively hybridized to an E. coli K-12 MG1655 tiling array with overlapping probes at ~12bp spacing across the entire genome. The series contains 12 datasets.

2012-11-01 | E-GEOD-41936 | biostudies-arrayexpress

Genome-wide identification of natural RNA aptamers in prokaryotes and eukaryotes

Project description:RNAs are well-suited to act as cellular sensors that detect and respond to metabolite changes in the environment due to their ability to fold into complex structures. Here, we introduce a genome-wide strategy called PARCEL that experimentally identifies RNA aptamers in vitro, in a high-throughput manner. By applying PARCEL to a collection of prokaryotic and eukaryotic organisms, we have revealed 58 new RNA aptamers to three key metabolites, greatly expanding the list of natural RNA aptamers. The newly identified RNA aptamers exhibit significant sequence conservation, are highly structured and show an unexpected prevalence in coding regions. We identified a prokaryotic precursor tmRNA that acts as a vitamin B2 (FMN) binder to facilitate its maturation, as well as new coding-region eukaryotic riboswitches that bind and respond to FMN, highlighting FMN as a second class of eukaryotic riboswitches. PARCEL results show that RNA-based sensing and gene regulation is more widespread than previously appreciated in different organisms.

2018-03-06 | GSE106133 | GEO

ssDNA aptamers against amyloid-β peptide as biomarker and inhibtor [SELEX]

Project description:We report high-affinity ssDNA aptamers as biomarkers and antagonists of amyloid-β peptide. We generated three novel aptamer sequences from the pool of aptamers through the SELEX process, and evaluated their affinity and sensitivity using enzyme-linked immunosorbent assay (ELISA). (The forward primer: ATTAGTCAAGAGGTAGACGCACATA, reverse primer TTCTGGTCGTCGTGACTCCTAT) The ssDNA aptamers modeled into a three-dimensional structure; interaction and mechanism of action derived through molecular dynamics simulations (MD). MD simulations revealed the nature of binding and inhibition of aggregation by binding with amyloid-β peptide monomers, dimers, and other oligomers. The presence of high non-bonded interaction energy along with hydrogen bonds constitutes the complex structure of the aptamer-amyloid-β peptide. Furthermore, the changes in the secondary structure induced by aptamers may help remove the peptide through the blood-brain barrier. This study provided a framework for the application of aptamers against amyloid-β peptides as biomarkers and antagonists.

2019-09-30 | GSE124865 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data