Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

GNPS - SEED Covian Mouse Fecal

ABSTRACT: Metabolic analysis of how APE1 protects the digestive tract from DNA damage initiated by bacterial infection, using mouse fecal samples and a standard methanol extraction. Data was acquired using a Bruker Daltonics maXis Impact and C18 RP-UHPLC. Positive polarity acquisition of LC-MS/MS.

INSTRUMENT(S): maXis

ORGANISM(S): Mus Musculus (ncbitaxon:10090)

SUBMITTER: Peter Ernst

PROVIDER: MSV000083302 | GNPS | Mon Jan 07 15:20:00 GMT 2019

REPOSITORIES: GNPS

ACCESS DATA

Json Xml

Similar Datasets

Bovine Respiratory Disease Complex

Project description:Bovine respiratory epithelial cells have different susceptibility to bovine respiratory syncytial virus infection. The cells derived from the lower respiratory tract were significantly more susceptible to the virus than those derived from the upper respiratory tract. Pre-infection with virus of lower respiratory tract with increased adherence of P. multocida; this was not the case for upper tract. However, the molecular mechanisms of enhanced bacterial adherence are not completely understood. To investigate whether virus infection regulates the cellular adherence receptor on bovine trachea-, bronchus- and lung-epithelial cells, we performed proteomic analyses.

2020-07-28 | PXD019509 | JPOST Repository

mouse fecal

Project description:mouse fecal Raw sequence reads

| PRJNA765460 | ENA

mouse fecal

Project description:mouse fecal Raw sequence reads

| PRJNA542037 | ENA

Mouse models with defective DNA damage repair

Project description:Mouse models with defective DNA damage repair

| PRJNA492800 | ENA

Gene Array to Predict Bacterial Infection with in Respiratory Illness

Project description:<p>Accurate tests for microbiologic diagnosis of lower respiratory tract infections (LRTI) are needed. Gene expression profiling of whole blood represents a powerful new approach for analysis of the host response during respiratory infection that can be used to supplement pathogen detection testing. Using qPCR, we prospectively validated the differential expression of 10 genes previously shown to discriminate bacterial and non-bacterial LRTI confirming the utility of this approach. In addition, a novel approach using RNAseq analysis identified 141 genes differentially expressed in LRTI subjects with bacterial infection. Using "pathway-informed" dimension reduction, we identified a novel 11 gene set (selected from lymphocyte, α-linoleic acid metabolism, and IGF regulation pathways) and demonstrated a predictive accuracy for bacterial LRTI (nested CV-AUC=0.87). RNAseq represents a new and an unbiased tool to evaluate host gene expression for the diagnosis of LRTI.</p>

| phs001248 | dbGaP

Plasma DNA end analysis (mouse)

Project description:Plasma DNA end analysis (mouse)

| EGAS00001006700 | EGA

Mouse DNA methylation atlas using Infinium Mouse Methylation Beadchips

Project description:Mouse DNA methylation atlas using Infinium Mouse Methylation Beadchips

| PRJNA764585 | ENA

DNA Damage Responses in Mouse Primordial Germ Cells

Project description:DNA Damage Responses in Mouse Primordial Germ Cells

| PRJNA641697 | ENA

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

mouse fecal bolus

Project description:mouse fecal bolus Raw sequence reads

| PRJNA798782 | ENA