Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

GNPS - SEED Covian Mouse Fecal

ABSTRACT: Metabolic analysis of how APE1 protects the digestive tract from DNA damage initiated by bacterial infection, using mouse fecal samples and a standard methanol extraction. Data was acquired using a Bruker Daltonics maXis Impact and C18 RP-UHPLC. Positive polarity acquisition of LC-MS/MS.

INSTRUMENT(S): maXis

ORGANISM(S): Mus Musculus (ncbitaxon:10090)

SUBMITTER: Peter Ernst

PROVIDER: MSV000083302 | GNPS | Mon Jan 07 15:20:00 GMT 2019

REPOSITORIES: GNPS

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Project description:Determination of how APE1 protects the digestive tract from DNA damage initiated by commensal bacteria

| PRJEB36945 | ENA

Iwamoto2010 - Cell cycle reponse to DNA damage

Project description:After DNA damage, cells activate p53, a tumor suppressor gene, and select a cell fate (e.g., DNA repair, cell cycle arrest, or apoptosis). Recently, a p53 oscillatory behavior was observed following DNA damage. However, the relationship between this p53 oscillation and cell-fate selection is unclear. Here, we present a novel model of the DNA damage signaling pathway that includes p53 and whole cell cycle regulation and explore the relationship between p53 oscillation and cell fate selection. The simulation run without DNA damage qualitatively realized experimentally observed data from several cell cycle regulators, indicating that our model was biologically appropriate. Moreover, the comprehensive sensitivity analysis for the proposed model was implemented by changing the values of all kinetic parameters, which revealed that the cell cycle regulation system based on the proposed model has robustness on a fluctuation of reaction rate in each process. Simulations run with four different intensities of DNA damage, i.e. Low-damage, Medium-damage, High-damage, and Excess-damage, realized cell cycle arrest in all cases. Low-damage, Medium-damage, High-damage, and Excess-damage corresponded to the DNA damage caused by 100, 200, 400, and 800 J/m(2) doses of UV-irradiation, respectively, based on expression of p21, which plays a crucial role in cell cycle arrest. In simulations run with High-damage and Excess-damage, the length of the cell cycle arrest was shortened despite the severe DNA damage, and p53 began to oscillate. Cells initiated apoptosis and were killed at 400 and 800 J/m(2) doses of UV-irradiation, corresponding to High-damage and Excess-damage, respectively. Therefore, our model indicated that the oscillatory mode of p53 profoundly affects cell fate selection.

2024-09-02 | BIOMD0000000939 | BioModels

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

DDW fecal samples

Project description:Metabolite analysis of DDW fecal samples, standard methanol extraction. Data were acquired using a Bruker Daltonics maXis Impact and C18 RP-UHPLC. Positive polarity acquisition of LC-MS/MS.

2018-05-09 | MSV000082354 | MassIVE

Prototheca zopfii genotype proteomics analysis

Project description:The present study was initiated to evaluate the quantitative proteomic profiling of Protothecazopfiigenotypes. The cells (P.zopfii genotype 1 –noninfectious and genotype 2 -infectious) were cultured in triplicates until the mid-logarithmic growth phase; the proteins were extracted after sonication on ice, followed by 2D DIGE separation as recommended by the manufacturer (GE Healthcare). The differentially expressed proteins spots were identified using Decodon software analysis (Delta 2D version 4.0 software). Protein identification was carried out by MALDI TOF MS/MS (Ultraflex III TOF/TOF, Bruker Daltonics, Bremen, Germany). The spectra was acquired using the automated option (AutoXecute ) of the Flex Analysis software version 3.3 (Bruker Daltonics, Leipzig, Germany), processed using Flex analysis software version 3.3 (Bruker Daltonics, Leipzig, Germany) and the database search was conducted using the MS/MS ion search (MASCOT, http://www.matrixscience.com) against all entries of NCBInr (GenBank)/Swissprot with subsequent parameters: trypsin digestion, up to one missed cleavage, fixed modifications: carbamidomethyl and with the following variable modifications: oxidation (M), peptide tol.: +- 1.2 Da, MS/MS tol.: +- 0.6 Da, peptide charge: +1. The results were assessed using MOWSE score, p- and E values and those possess positive hits with cRAP database were eliminated from the list.

2013-07-22 | PXD000126 | Pride

Carnivore fecal samples

Project description:Understanding predator guild niche partitioning using DNA metabarcoding

| PRJNA1103791 | ENA

Raw N-glycan MALDI mass spectrometry imaging data on formalin-fixed mouse kidney

Project description:The N-glycome was mapped and visualised on formalin-fixed mouse kidney tissue using an ultrafleXtreme MALDI-ToF/ToF MS instrument (Bruker Daltonics).

2018-11-02 | PXD009808 | Pride

HDAC1 modulates OGG1-initiated oxidative DNA damage repair, brain aging, and Alzheimer’s disease pathology

Project description:HDAC1 modulates OGG1-initiated oxidative DNA damage repair, brain aging, and Alzheimer’s disease pathology

| PRJNA474958 | ENA

Exploring the landscape of somatic mutations in normal tissue GI MAP WGS

Project description:Somatic mutations (burdens and signatures) and clonal dynamics in normal human tissues from the gastrointestinal tract of individuals with tumour predisposition syndromes and DNA damage repair defects.

| EGAS00001004122 | EGA

Exploring the landscape of somatic mutations in normal tissue GI LYNCH WGS

| EGAS00001003882 | EGA