Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Ubiquitin-modified proteome analysis of wildtype and UFD1s-deficient HEK293T cells

ABSTRACT: To order to determine cellular ubiquitination levels, wildtype (WT) and UFD1s-deficent (MUT) cells were treated with 25 μM MG132 for 6 h. Cells were then lysed in UA buffer (8 M Urea, 100 mM Tris-HCl pH 8.5) on ice for 10 min. Cells were harvested, frozen in liquid nitrogen and stored at -80 ℃ for further ubiquitin (label-free)-modified proteome.

ORGANISM(S): Homo Sapiens

SUBMITTER: Ge Shan

PROVIDER: PXD038683 | iProX | Thu Dec 08 00:00:00 GMT 2022

REPOSITORIES: iProX

ACCESS DATA

Json Xml

Similar Datasets

RNAseq of SEC23B wildtype (WT) and mutant (MUT) thyroid cell lines treated with Tunicamycin (Tunica, ER stress)

Project description:We report gene expression changes between SEC23B WT and MUT cells after treatment with Tunicamycin. The overall goal is to agnostically determine impacted signaling pathways in the wildtype and mutant settings.

2020-08-31 | GSE112661 | GEO

Parp-1 wildtype and deficient mouse embryonic stem cells

Project description:Genome-wide methylation analysis was performed by methylated DNA immunoprecipitation (MeDIP)-CpG island (CGI) microarray analysis to identify the CpG methylation levels of Parp-1 wildtype, Parp-1 deficient or Parp inhibitor treated mouse embryonic stem cells.

2014-12-31 | GSE37651 | GEO

Transcriptional profiling of wildtype versus Themis2-deficient follicular B cells

Project description:Transcriptional profiling of wildtype versus Themis2-deficient follicular B cells

| PRJEB6126 | ENA

Transcriptomics analysis of gene expression in wildtype and foxo1 synonymous mutated mouse liver

Project description:The selected gRNA sequence is tggcatgtttattgagcgctTGG. To disrupt the demethylation motif RRACT in 2288-2290 of Foxo1 mRNA (NM_019739), a mutation (ttGGACT to ctCGATT) target vector was constructed with 1214bp 5’arm and 849bp 3’arm. Mouse zygotes obtained by mating of males with superovulated C57BL/6J females, were injected with a mixture of Cas9 mRNA (80 ng/μl), sgRNA (40 ng/ul) and Donor vector (8 ng/ul). Microinjections were performed into the male pronucleus of fertilized oocytes. Injected zygotes were transferred into pseudopregnant CD1 female mice, and viable adult mice were obtained. Mice were genotyped using sequencing and PCR. PCR primers: mut-F1, ATCCCCATTGAGCAGTAAGTTTTCCA; mut-R1, TGATGGACTCCATGTCACAATCGAG; mut-F2, GCATGTTTATTGAGCGCCTCGAT; mut-R2, CCGCTGTTGCCAAGTCTGAGG; wt-R1, TGATGGACTCCATGTCACAGTCCAA. PCR genotyping of wild-type (wt) and mutant (mut) mice was using primers mut-F1 and mut-R1 to generate fragments of 1291 bp for mut allele, using primers mut-F2 and mut-R2 to generate fragments of 930 bp for mut allele, and using primers mut-F1 and wt-R1 to generate fragments of 1291 bp for wt allele. Total RNA was isolated from Liver Tissue using the TRIzol (Invitrogen) reagent by following the company manual. For all samples the RNA integrity was checked using an Agilent Bioanalyzer 2100. Approximately 2.5 µg of total RNA was then used for library preparation using a TruSeq™ RNA Sample Prep Kit v2 (Illumina, San Diego, CA, USA) according to the manufacturer’s protocol.The libraries were sequenced using HiSeq3000 (Illumina) in paired-read mode, creating reads with a length of 101 bp. Sequencing chemistry v2 (Illumina) was used.

2022-01-26 | GSE125786 | GEO

Comparative analysis of Tet2 catalytic deficient and knockout bone marrow over time

Project description:In this study, we investigated the role of Tet2 in regulation of hematopoietic genes by performing transcriptomic analysis of Tet2 WT, Mut, and KO LSK and Lin– cells at 3, 6, 9, and 12 months by RNA-seq, and mapping the DNA methylation landscape of 3-month-old Tet2 WT, Mut, and KO LSK and Lin– cells. (1) We find that loss of Tet2 (Tet2 KO) vs. a loss of Tet2 catalytic function (Tet2 Mut) at different time points and cell types causes distinct gene expression changes when compared to WT samples as assessed by RNA-seq. (2) Additionally, we find that many genes implicated in lymphoma and leukemia are deregulated in Tet2 Mut and KO LSK and Lin– cells, consistent with the phenotypes observed in mice transplanted with Tet2 Mut and KO bone marrow. (3) We also mapped genome-wide DNA methylation levels of WT, Tet2 Mut, and KO LSK and Lin– cells at 3 months by WGBS and establish a role for Tet2 in demethylating genes implicated in lymphoma and leukemia initiation and progression.

2023-06-01 | GSE227977 | GEO

Expression data of wildtype and miR-146a-deficient 2D2 transgenic T cells

Project description:We used the Affymetrix GeneChip Mouse Genome 430 2.0 Arrays to compare the gene expression profiles of wildtype and miR-146a-deficient 2D2 transgenic T cells.

2017-09-05 | GSE101165 | GEO

RNA-sequencing analysis of differentiating wildtype and Ezh2 deficient immature mouse chondrocytes

Project description:Objective: To evalute the role of Ezh2 in chondrocyte differentiation. Method: Ezh2 was inactivated in chondrocytes using the Col2a1-Cre driver in vivo. Immature mouse chondrocytes (IMC) were isolated from wildtype and Ezh2 deficient mice, and plated in micromass culture. Chondrocytes were differentiated and RNA was isolated at days 3, 7, and 14 of culture. Isolated RNA was subjected to RNA sequencing analysis. Results: Ezh2 deficient chondrocytes exhibit enhanced expression of osteogenic genes compared to wildtype cells.

2017-03-29 | GSE97118 | GEO

Gene expression data from HEK293T cells stably expressing human TRAF7 wildtype or G536S mutant isoforms

Project description:The TRAF7 gene is recurrently mutated in meningiomas, adenomatoid tumors of the genital tract, well-differentiated papillary mesotheliomas, and intraneural perineuriomas. However, the mechanisms by which these recurrent missense mutations contribute to tumorigenesis has not yet been described. To elucidate the transcriptional differences between HEK293T cells overexpressing wildtype vs mutant TRAF7, we used Affymetrix microarrays to identify the gene transcripts that are upregulated and downregulated depedent on TRAF7 status.

2021-06-01 | GSE136012 | GEO

Catalytic dependent and independent roles of Tet3 in activation of ectodermal and silencing of mesodermal programs during neuroectoderm specification

Project description:In this study: (1) we distinguished Tet3 target genes that are regulated by its catalytic vs. noncatalytic functions in neuroectoderm (NE) cells by transcriptomic profiling of Tet3 wildtype (WT), Tet3 catalytic mutant (Mut), and Tet3 knockout (KO) NE cells by RNA-seq. (2) We mapped genome-wide DNA methylation of Tet3-WT, Tet3-Mut, and Tet3-KO NE cells by WGBS. (3) We determined Tet3 genome-wide occupancy in Tet3-WT NE cells by CUT&Tag. (4) We mapped 5hmC rich regions in Tet3-WT, Tet3-Mut, and Tet3-KO NE cells by hmeDIP. (5) We overexpressed (OE) the Tet3 target gene Dnmt1 (D) or an empty vector (EV) in Tet3-WT, Tet3-Mut, and Tet3-KO NE cells and assessed gene expression by RNA-seq. (6) We overexpressed (OE) Tet3 (T) or an empty vector (EV) in Tet3-WT, Tet3-Mut, and Tet3-KO NE cells and examined gene expression changes in these cells by RNA-seq.

2024-04-02 | GSE237800 | GEO

Transcriptomes of Nfi deficient and wildtype mouse neocortical tissue at E16

Project description:Here, we generated transcriptomes of microdissected neocortex of Nfia knockout, Nfib knockout and wildtype littermate embryos at embryonic day 16.

2017-10-27 | GSE93604 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data