Two C4 variants are translated during virus infection
Ontology highlight
ABSTRACT:
ORGANISM(S): Nicotiana Benthamiana
SUBMITTER: 
Xueping Zhou
PROVIDER: PXD040260 | iProX | Fri Feb 17 00:00:00 GMT 2023
REPOSITORIES: iProX
Similar Datasets
Project description:Virus-infected tissues (1g) of N. benthamina plants at 14 days post-inoculation (dpi) were harvested and ground in 10 ml protein extraction buffer [4% (w/v) SDS; 100 mM Tris-HCl pH 7.6, and 100mM DTT], then centrifuged at 8,000 g at 4℃ for 10 min, and the soluble proteins in the supernatant were digested by Glu-C proteinase and then used for mass spectrometry analysis.
2022-11-03 | PXD037948 |
Project description:Nodules were compared to inoculated roots. Nodules 4 days post inoculation (dpi), 10 dpi, 14 dpi were used. At 14 dpi, nitrogen was added and nodules at 16 dpi were harvested. Bacterial mutants ExoA, BacA and FixJ were used and nodules were harvested at 10 dpi.
2009-07-15 | E-TABM-688 | biostudies-arrayexpress
Project description:Plant resistance inducers (PRIs) are compounds that protect crops from diseases by activating plant immunity. The exogenous treatment with glutamate (Glu), an important amino acid for living organisms, was shown to induce resistance against fungal pathogen in rice and tomato. To understand the molecular mechanism of Glu-induced immunity, we developed a model system using Arabidopsis thaliana. Here, we found that exogenous treatment with Glu to Arabidopsis enhances resistance against Pseudomonas syringae pv. tomato DC3000 and Colletotrichum higginsianum. Consistently, transcriptome analyses of Arabidopsis seedlings treated with Glu showed that Glu significantly induces the expression of wound, defense, and stress related genes. Interestingly, Glu activates the expression of pathogen or damage associated molecular patterns (PAMP or DAMP)–inducible genes at much later time points than PAMP/DAMPs normally do. Moreover, expression of Glu-inducible genes does not require known components of PAMP receptor complex, glutamate receptors, salicylic acid-biosynthesis enzyme, or glutamate decarboxylase. In addition, Glu also enhances PAMP-inducible immune responses, such as production of reactive oxygen species and mitogen-activated protein kinase activation. These results show that Glu activates PAMP/DAMP-triggered immunity signaling pathway in a novel manner.
2019-12-06 | GSE123621 | GEO
Project description:Plant resistance inducers (PRIs) are compounds that protect crops from diseases by activating plant immunity. The exogenous treatment with glutamate (Glu), an important amino acid for living organisms, was shown to induce resistance against fungal pathogen in rice and tomato. To understand the molecular mechanism of Glu-induced immunity, we developed a model system using Arabidopsis thaliana. Here, we found that exogenous treatment with Glu to Arabidopsis enhances resistance against Pseudomonas syringae pv. tomato DC3000 and Colletotrichum higginsianum. Consistently, transcriptome analyses of Arabidopsis seedlings treated with Glu showed that Glu significantly induces the expression of wound, defense, and stress related genes. Interestingly, Glu activates the expression of pathogen or damage associated molecular patterns (PAMP or DAMP)–inducible genes at much later time points than PAMP/DAMPs normally do. Moreover, expression of Glu-inducible genes does not require known components of PAMP receptor complex, glutamate receptors, salicylic acid-biosynthesis enzyme, or glutamate decarboxylase. In addition, Glu also enhances PAMP-inducible immune responses, such as production of reactive oxygen species and mitogen-activated protein kinase activation. These results show that Glu activates PAMP/DAMP-triggered immunity signaling pathway in a novel manner.
2019-12-06 | GSE123620 | GEO
Project description:Arabidopsis was transformed with the NIK receptor or the mutant T474D NIK receptor and infected with CaLCuV. The global variation of gene expression was analysed by RNA-seq at 10 days post inoculation and 20 days post inoculation and differential gene expression was determinated in comparison with mock inoculated Arabidopsis lines. Pairwise comparison between mock inoculated and infected genotypes (WT,NIK-expressing lines and T474D-expressing lines) at 10 dpi and 20 dpi
2014-04-21 | E-GEOD-56922 | biostudies-arrayexpress
Project description:Tomato seeds (S. lycopersicum ‘Fl Lanai’) were germinated under greenhouse conditions maintained at 24°C-29°C in flat trays (BWI Apopka, Catalog Number GPPF72S7X) filled with Sungro Horticulture soil (Metro-mix 830, BWI Apopka, Cat# TX830). Two weeks post emergence seedlings were transplanted to 4” pots using the same soil and transferred to a Conviron walk-in growth chamber (CMP6060) for the remainder of the experiment. Conviron conditions include a 14h/10h light/dark cycle maintained at 28°C, and plants were fertilized weekly (20-20-20). To prevent cross contamination, tomato plants were confined to insect proof cages at all times (BioQuip 1450NS68). Four weeks after transplanting, 40 whiteflies (B. tabaci MEAM1) were collected from virus free or Tomato Mottle Virus (ToMoV) established colonies via aspiration and moved into a clip cage placed on the 4th true leaf of each tomato plant as previously described38. Whiteflies were reared cabbage (Brassica oleracea), while viruliferous whiteflies were reared on ToMoV infected tomato from colonies established in the Polston lab. For all plants in this study, feeding was halted after 3 days of whitefly feeding (3 DPI) by gentle removal of clip cages and whitefly termination using insecticidal soap (Garden Safe, 1% of potassium salts of fatty acids). For the samples referred to as “local”, the tomato leaf bound within the clip cages was immediately removed and snap frozen for protein extraction. For the samples designated “systemic”, the plants were allowed to continue growing for 7 additional days after clip cage removal and whitefly termination, at which point the 9th leaf was excised and snap frozen. Plants used for collection of local leaves at 3 DPI were not used for the collection of systemic leaves 10 DPI. For both local and systemic leaves collected, we also included a no treatment control (NTC) that was subjected identically to clip cage and insecticidal soap applications, but without the addition of whitefly or ToMoV. Our experiment therefore consists of a no-treatment control (NTC), a whitefly treatment (+WF), and a viruliferous whitefly (+WFV) treatment for both local (4th true leaf, 3 DPI) and systemic leaves (9th true leaf, 10 DPI). The presence of ToMoV in all infected plants was confirmed via Nanopore sequencing. Briefly, Tomato genomic DNA was extracted from five systemic leaf samples using the PureGene tissue DNA isolation kit (product # 158667; QIAGEN, Valencia, CA, USA), following the manufacturer’s protocol and stored at -80°C until needed. Library preparation was performed using the Rapid Sequencing Kit RBK004 protocol (Oxford Nanopore Technologies) and loaded onto a 9.4.1 flow cell in a MinION connected to a MinIT with live base calling enabled. Resulting sequencing reads for each sample were mapped to both ToMoV A component (GenBank accession: L14460) and ToMoV B component (GenBank accession: L14461) sequences.
2020-10-02 | PXD019197 | Pride
Project description:Plant and virus materials, inoculation and symptom evaluation<br><br>Tomato seedlings, cultivar Tricia (De Ruiter seeds, Bergschenhoek, the Netherlands) were grown in stonewool in climate chamber conditions (22 and 20°C during day and night periods of 10 and 14 hours, respectively, at 75% relative humidity). At 29 days after planting, plants were inoculated with a mild (1906; GenBank accession number FJ457096) and an aggressive (PCH 06/104; GenBank accession number FJ457097) PepMV isolate of the CH2 genotype. Here, a PepMV isolate is defined as the viral inoculum derived from PepMV infected plants from one specific tomato production site. After inoculation, the genotype of both isolates was determined using a previously described RT-PCR-RFLP method (Hanssen et al., 2008). Inoculation was performed on the second fully developed leaf as previously described (Hanssen et al., 2008). <br><br>The phenotypic response of tomato seedlings upon inoculation was evaluated by recording the development of typical nettlehead-like PepMV symptoms at 4, 8 and 12 days post inoculation (DPI) on 20 plants per treatment. PepMV induced nettlehead-like symptoms are characterized by a reduced leaf surface, leaf bubbling and leaf deformation (Hanssen et al., 2008). Symptoms were scored from 0 (no symptoms) to 3 (severe symptoms) (Figure 1b). Significant (p<0.05) differences in symptom scores were identified by analysis of variance (one-way ANOVA) and post-hoc Bonferroni tests using SPSS software (v. 10.0; SPSS Inc., Chicago, IL, USA).<br><br><br><br>Microarray sample preparation and determination of viral titers<br><br>Tomato genes that were differentially regulated (more than twofold change with P value < 0,001) upon inoculation with the aggressive and mild PepMV isolates were identified at 4, 8 and 12 DPI using mock-inoculated control plants as a reference. At each time point, the youngest fully developed leaves from CH2 mild, CH2 aggressive and mock-inoculated plants were sampled for tomato gene chip hybridizations. Each plant was sampled only once. Three biological replicates, each consisting of pooled RNA extracts obtained from the youngest fully developed leaves of two seedlings, were analyzed per treatment. Total RNA was extracted using the RiboPure RNA extraction kit (Ambion) and reverse transcribed with labeled oligo-dT primers for hybridization onto custom-designed Affymetrix tomato GeneChip arrays (Syngenta Biotechnology, Inc., Research Triangle Park, North Carolina, US) that contains probe sets to interrogate 22,721 tomato transcripts (Van Esse et al., 2007). <br><br>Viral accumulation was measured using a PepMV-specific RT-qPCR assay with forward primer Pep5 (5' ATGAAGCATTCATACCAAAT 3') and reverse primer Pep4 (5' AATTCCGTGCACAACTAT 3'; Mumford & Metcalfe, 2001) respectively. PCR amplification was carried out using a Cepheid® Smart Cycler II thermocycler and analyzed using Smart Cycler software. The PCR program consisted of an initial denaturation step at 95°C for 15 min, 45 cycles of 15s at 94 ºC, 30 s at 50 °C and 30 s at 72 °C, followed by a final incubation step of 2 min at 72°C. Standard curves based on cDNA dilution series were generated to determine the relative concentrations of amplified viral RNA. Based on 4 replicates, run in two different analyses, a reaction efficiency of around 90% was obtained. Ct values obtained from the PepMV specific assay were standardized by subtraction from an internal control assay (efficiency 99%) amplifying a partial sequence of the ribulose 1.5-biphosphate carboxylase chloroplast gene (Sánchez-Navarro et al. 2005).<br><br>
2011-05-01 | E-MEXP-2389 | biostudies-arrayexpress
Project description:RNA-sequencing of Hordeum vulgare cv. Ingrid wild type and Hvmlo1-5 mutant in non-mycorrhizal (control) and mycorrhizal roots at 17 days post inoculation (dpi) and 26 dpi.
2020-01-25 | GSE144199 | GEO
Project description:We used Bio-Rad laboratories, lnc. PCR assay panel to analyze expression levels of bZIP genes in various biotci stress and plant hormone treatments. Tomato (Solanum lycopersicum) cv. Suhong 2003 were reared in growth chambers at 24 ± 1 °C with a photoperiod of 14 h light/10 h dark and light intensity of 200 μE m2 s-1. For analysis of gene expression, 4-week-old tomato plants were treated by foliar spraying with 100 μM methyl jasmonate (MeJA), 100 μM 1-amino cyclopropane-1-carboxylic acid (ACC), 100 μM SA or 0.1% ethanol as a control and samples were collected at indicated time points after treatment. For analysis of gene expression in response to pathogen infection, whole plant inoculation assays for B. cinerea (spore density of 1×10 5 spores/mL) and vacuum infiltrated inoculation assays for Pst DC3000 along with corresponding mock inoculation controls were performed.
2015-08-20 | GSE72215 | GEO