Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

TMT10plex HCV infection

ABSTRACT: TMT10plex global proteomics of HCV infected HuH7.5 cells or HCV infected humanized mouse livers. TMT channels were combined after labeling and separated off line with a highPH reverse phase fractionation into 24 fractions.

INSTRUMENT(S): Q Exactive HF-X

ORGANISM(S): Homo Sapiens (ncbitaxon:9606) Mus Musculus (ncbitaxon:10090)

SUBMITTER: Philipp Mertins

PROVIDER: MSV000083382 | MassIVE | Thu Jan 31 09:33:00 GMT 2019

REPOSITORIES: MassIVE

ACCESS DATA

Json Xml

Similar Datasets

Fasting Fed RNA sequencing experiment of mice with humanized livers

Project description:We report the RNA sequencing results of four fasting mice with humanized livers and four fed mice with humanized livers.

2019-10-04 | GSE126587 | GEO

Effects of HIV infection and opioids on gut microbiota

Project description:Opioid use is associated with worse outcome in HIV-infected patients. The exacerbated disease progression by opioids is mainly driven by increased epithelial damage and less regenerative response. The present study investigates how opioids potentiate HIV disease progression by impairing intestinal epithelial self-repair. Abnormal intestinal morphology and reduced epithelial proliferation were observed in HIV-infected humanized mice, which were exposed to opioids. For this study, we had 4 groups of BLT humanized mice- (A) Untreated, (B) Morphine treated, (C) HIV infected and (D) HIV infected + Morphine treated. HIV infection was done for 4 weeks and Morphine treatment was done for 7 days. Morphine treatment was done via subcutaneous implantation of slow-release morphine pellet in individual mouse in the appropriate groups. In other groups, a matching Placebo pellet was implanted.

2020-01-11 | E-MTAB-7883 | biostudies-arrayexpress

RNAseq analysis of CC F2 female mice at day3 after infection with Ebola virus

Project description:F2 female mice were generated from a cross of two collaborative cross (CC) strains, CC011 x CC074. These mice were infected with Ebola virus and liver samples were prepared at day three after infection. RNA from the livers were prepared and subjected to RNAseq analysis. This data set can be combined with data from GSE165142, in which female mice from the same cross were infected with Ebola virus, and liver samples were prepared at day six after infection. Results: Variations in gene expression levels that may be perdictive for severity

2022-08-31 | GSE173914 | GEO

The gene expression profile of humanized rat livers

Project description:We investigated the transcriptome of repopualted human hepatocytes in humanized rat livers.

2021-10-19 | GSE162862 | GEO

Expression data in human hepatocytes with HCV infection

Project description:Human hepatocyte chimeric mice were prepared and treated with hepatitis C virus (HCV) and/or interferon-alpha (IFN-Î±). To analyze the changes in gene expression, cDNA microarray analysis was performed with the collected human hepatocytes from the chimeric mouse livers. We consider that these results provide molecular insights into possible mechanisms used by HCV to evade innate immune responses, as well as novel therapeutic targets and a potential new indication for interferon therapy. A total of 15 human hepatocyte chimeric mice were prepared and divided into four experimental groups. Mice in group A were neither infected with HCV nor treated with IFN. Mice in group B were administered IFN-Î± 6 h before sacrifice but were not infected with HCV. The mice in groups C and D were both inoculated via the mouse tail vein with human serum containing HCV genotype 1b particles. At 8 weeks after inoculation, the mice in group D were administered IFN-Î± 6 h before sacrifice, but the mice in group C were not treated with IFN-Î±. The human hepatocytes in the mouse livers were collected after sacrifice and subjected to microarray analysis. After purification and reverse transcription of total RNA, cDNA was hybridized on Affymetrix GeneChip Human Gene U133 Plus 2.0 Arrays.

2012-05-02 | E-GEOD-37715 | biostudies-arrayexpress

Roles and Programming of Arabidopsis ARGONAUTE Proteins During Turnip Mosaic Virus Infection

Project description:AGO protein immunoprecipitation was combined with high-throughput sequencing of associated small RNAs. AGO2, AGO10, and to a lesser extent AGO1 were shown to associate with siRNAs derived from silencing suppressor (HC-Pro)-deficient TuMV-AS9, but not with siRNAs derived from wild-type TuMV. Co-immunoprecipitation and small RNA sequencing revealed that viral siRNAs broadly associated with wild-type HC-Pro during TuMV infection. These results support the hypothesis that suppression of antiviral silencing during TuMV infection, at least in part, occurs through sequestration of virus-derived siRNAs away from antiviral AGO proteins by HC-Pro. Catalytic mutant HA-AGO1-DAH, HA-AGO2-DAD and HA-AGO10-DAH or catalytically active HA-AGO10-DDH were immunoprecipitated from buffer (mock) or inoculated rosette leaves (at 7 dpi) or noninoculated cauline leaves at 10 dpi with wt TuMV or suppressor-deficient TuMV-AS9. Inflorescence from TuMV infected plants was collected at 10 dpi with wt TuMV. HC-Pro was tagged with 6xHIS in TuMV-HIS and suppressor-deficient TuMV-HIS-AS9. HC-Pro was immunoprecipitated from noninoculated cauline leaves of inflorescence at 10 dpi. HC-Pro AS9 was immunoprecipitated from noninoculated cauline leaves at 15 dpi. Total RNA was extracted from input fraction and small RNAs separated by size fractionation. Small RNAs in input and HA-AGO or HC-Pro immunoprecipitation fractions were converted to DNA Amplicons by 5' (GUUCAGAGUUCUACAGUCCGACGAUC) or 3’ (CTGTAGGCACCATCAAT) adaptor ligation followed by RT-PCR. DNA Amplicons were sequenced using the Illumina HiSeq2000 platform. Duplicate libraries were made per treatment. For each library, hits to TuMV, to TuMV-HIS and to Arabidopsis thaliana were included in separate files.

2015-04-06 | E-GEOD-64911 | biostudies-arrayexpress

mRNA expression levels in splenic human CD4-positive T cells of mock-infected, HIV-1-infected and pegIFN-treated humanized mice

Project description:Through RNA sequencing and reactome analyses, we report that type I interferon response is elicited in the spleen of HIV-1-infected humanized mice when compared to mock-infected humanized mice.

2017-10-13 | GSE94776 | GEO

mRNA expression levels in splenic human mononuclear cells of mock- and HIV-1-infected humanized mice

Project description:Through RNA sequencing and gene ontology analyses, we report that immune activation is elicited in the spleen of 4 HIV-1-infected humanized mice when compared to 4 mock-infected humanized mice.

2017-04-28 | GSE92262 | GEO

Bioinformatics approaches for viral metagenomics in plants using short RNAs : model case of study and application to a Cicer arietinum population

Project description:Size fractionated small RNA from total RNA extracts of Cicer arietinum leaves and from Nicotiana benthamiana infected by Cymbidium ringspot virus were mixed in a ratio of 1000 to 1 in amount, respectively. The RNA was ligated to adapters, purified again and reverse transcribed. After PCR amplification the sample was subjected to Illumina high throughput pyrosequencing. The kit used is TrueSeq Small RNA kit Please see www.illumina.com for details of the sequencing technology. Short RNA fractionation and characterization

2015-01-30 | E-GEOD-63378 | biostudies-arrayexpress

Tear proteome analysis by LC-MS/MS

Project description:We have analysed the tear proteome from multiple volunteers without ocular disease using untargeted LC-MS/MS with and without pre-fractionation of peptide digests. Standard LC-MS/MS was compared to results from fractionation by mixed-mode cation exchange SPE and reverse-phase HPLC fractionation. The combined analysis of all these samples resulted in the identification of 886 proteins.

2023-09-01 | PXD041752 | Pride

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data