Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

High-Throughput Screening of Amyloid Inhibitors via Covalent-Labeling Mass Spectrometry

ABSTRACT: MS spectra of DEPC modifications on beta-2-microglobulin (b2m) residues under amyloid-forming conditions, with or without 4-hydroxythalidomide.

INSTRUMENT(S): Orbitrap Fusion

ORGANISM(S): Homo Sapiens (ncbitaxon:9606)

SUBMITTER: Richard W. Vachet

PROVIDER: MSV000098322 | MassIVE | Wed Jun 25 09:42:00 BST 2025

REPOSITORIES: MassIVE

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Publications

High-Throughput Screening of Amyloid Inhibitors via Covalent-Labeling Mass Spectrometry.

Khamnong Kanitin K Stahl Vanessa L VL Izikson Olivia N ON Devarajan Anirudh A Thayumanavan S S Vachet Richard W RW

Analytical chemistry 20250619

Amyloid fibril formation by proteins is implicated in numerous human diseases, yet few treatments exist in part due to the lack of robust screening methods for amyloid inhibitors. Here, we demonstrate a novel mass spectrometry (MS) assay for high-throughput screening of amyloid inhibitors, based on measuring the extent of protein labeling during protein aggregation. Amyloid formation decreases covalent labeling (CL) extents, while the presence of an inhibitor restores the extent of labeling, pro ...[more]

PMID: 40537900

Similar Datasets

Tracking peripherally administered Amyloid-beta by stable isotope labeling-based proteomics

Project description:Findings of early cerebral Amyloid-beta deposition in mice after peripheral injection of Amyloid-beta containing brain extracts, and humans following cadaveric human growth hormone treatment raised concerns that Amyloid-beta aggregates and possibly Alzheimer disease (AD) may be transmissible between individuals. Yet, proof that Amyloid-beta actually reaches the brain from the peripheral injection site is lacking. Here, we used a proteomic approach combining stable isotope labeling of mammals and untargeted and targeted mass spectrometry. Specifically, we generated 13C-isotope labeled brain extracts from mice expressing human Amyloid-beta and track 13C-Lys-labeled Amyloid-beta after intraperitoneal administration into young Amyloid betaPP transgenic mice. We detected injected Amyloid-beta in the liver and lymphoid tissues for up to 100 days. In contrast, injected 13C-Lys-labeled Amyloid-beta was not detectable in the brain whereas the mice incorporated 13C-Lys from the donor brain extracts into endogenous Amyloid-beta. Using a highly sensitive and specific proteomic approach, we demonstrated that Amyloid-beta does not reach the brain from the periphery. Our study argues against potential transmissibility of AD while opening new avenues to uncover mechanisms of pathophysiological protein deposition. Please note that corresponding MRM data for this project have been submitted elsewhere.

2022-04-29 | MSV000089339 | MassIVE

Modulation of gene expression by complement protein C1q in amyloid-beta injured neurons

Project description:Complement protein C1q is induced after injury in the brain and during Alzheimer's disease and has been shown to protect against amyloid-beta induced neuronal death. In this study, we used microarray approach to identify the pathways modulated by C1q that are associated with neuroprotection. Immature rat cortical primary neurons are treated with fibrillar amyloid-beta peptides and/or C1q for 3h before RNA extraction and hybridization on rat Affymetrix microarrays. Supplementary file: Processed/normalized, probe-level signal intensities from neurons treated with amyloid-beta or C1q. Median signal intensity used as global normalization method, done with JMP genomics (v5.0) software.

2012-12-21 | E-GEOD-28886 | biostudies-arrayexpress

Transcriptomic changes mediated by β-amyloid in human aortic endothelial cells (HAOEC)

Project description:We found that β-amyloid accumulation is modulated in HAOEC cells by overexpression or blocking of lncRNA BACE1-AS, which in turn regulates both BACE1 mRNA and protein expression. BACE1 is key-enzyme in the synthesis of β-amyloid from Amyloid Precursor Protein (APP). The transcriptomic changes mediated by 400nM β-amyloid was investigated in HAOEC cells.

2018-12-31 | GSE84620 | GEO

Transcription profiling of human cholinergic SN56.B5.G4 cells treated with beta-amyloid or hydrogen peroxide

Project description:Effect of beta-Amyloid and oxidative stress on gene expression in cholinergic SN56.B5.G4-cells

2005-01-01 | E-MEXP-710 | biostudies-arrayexpress

High-Throughput Screening at the Membrane Interface Reveals Inhibitors of Amyloid-β.

Project description:Aggregation and the formation of oligomeric intermediates of amyloid-β (Aβ) at the membrane interface of neuronal cells are implicated in the cellular toxicity and pathology of Alzheimer's disease. Small molecule compounds have been shown to suppress amyloid aggregation and cellular toxicity, but often the presence of a lipid membrane negates their activity. A high-throughput screen of 1800 small molecules was performed to search for membrane active inhibitors, and 21 primary hits were discovered. Through the use of fluorescence-based assays, transmission electron microscopy, and dot blot assays, the initial 21 primary hits were narrowed down to five lead compounds. Nuclear magnetic resonance and circular dichroism experiments were used for further confirmation of amyloid inhibition at the membrane interface and to obtain insights into the secondary structure of amyloid-β, while size exclusion chromatography was used to characterize the size of Aβ species. Lastly, dye-leakage assays allowed us to understand how the addition of the five lead compounds affected amyloid-β's ability to permeate the lipid bilayer. These results provide insights into small molecules that stabilize small amyloid species in the presence of membranes for the development of tool compounds for deeper investigations of these transient species.

| S-EPMC10323872 | biostudies-literature

Genetic variants associated with amyloid-beta uptake in Korean population

Project description:Gene-based association study with amyloid-beta uptake

2023-09-18 | PRJEB66172 | EVA

12hr, 1d, 3d, and 5d exposure of beta-amyloid to astrocytes

Project description:Cortical type-I astrocytes were cultured on the beta-amyloid peptide 25-35 fragment for 12hr, 1d, 3d, and 5d. Keywords = amyloid astrocytes rat Keywords: time-course

2003-12-09 | GSE856 | GEO

ssDNA aptamers against amyloid-β peptide as biomarker and inhibtor [SELEX]

Project description:We report high-affinity ssDNA aptamers as biomarkers and antagonists of amyloid-β peptide. We generated three novel aptamer sequences from the pool of aptamers through the SELEX process, and evaluated their affinity and sensitivity using enzyme-linked immunosorbent assay (ELISA). (The forward primer: ATTAGTCAAGAGGTAGACGCACATA, reverse primer TTCTGGTCGTCGTGACTCCTAT) The ssDNA aptamers modeled into a three-dimensional structure; interaction and mechanism of action derived through molecular dynamics simulations (MD). MD simulations revealed the nature of binding and inhibition of aggregation by binding with amyloid-β peptide monomers, dimers, and other oligomers. The presence of high non-bonded interaction energy along with hydrogen bonds constitutes the complex structure of the aptamer-amyloid-β peptide. Furthermore, the changes in the secondary structure induced by aptamers may help remove the peptide through the blood-brain barrier. This study provided a framework for the application of aptamers against amyloid-β peptides as biomarkers and antagonists.

2019-09-30 | GSE124865 | GEO

Transcription profiling of rat astrocytes cultured on the beta-amyloid peptide 25-35 fragment for 12 hours, 1, 3 and 5 days

Project description:Cortical type-I astrocytes were cultured on the beta-amyloid peptide 25-35 fragment for 12hr, 1d, 3d, and 5d.

2007-10-12 | E-GEOD-856 | biostudies-arrayexpress

Immortalized mouse microglia cell (IMG) response to amyloid beta treatment

Project description:RNA-seq analysis of IMG after 8 hours fibril or oligomeric amyloid beta treatment.

2021-04-02 | GSE171338 | GEO