Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Metabolomics analysis revealed the effects of different treatments on the metabolic profile of HaCaT cells

ABSTRACT: To investigate the regulatory effects of the ECM@SF-AGS-CS-LA hydrogel (HC), exosomes (HB), and their combination (HA) on the metabolic profiles of wound tissues in diabetic mice, HaCaT keratinocytes were employed as an in vitro cellular model. Untargeted metabolomics profiling was performed on HaCaT cells subjected to the respective treatments. Five pairwise comparisons were conducted: HC versus HD (diabetic control), HB versus HD, HA versus HD, HA versus HC, and HA versus HB. KEGG pathway enrichment analysis was applied to identify biologically relevant pathways significantly associated with differentially abundant metabolites (P < 0.05). This analysis revealed 8, 28, 30, 30, and 97 significantly enriched pathways in the HC vs HD, HB vs HD, HA vs HD, HA vs HC, and HA vs HB comparisons, respectively.

INSTRUMENT(S): Liquid Chromatography MS - alternating - normal-phase

PROVIDER: MTBLS14481 | MetaboLights | 2026-05-14

REPOSITORIES: MetaboLights

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	a_MTBLS14481_LC-MS_alternating_normal-phase.txt	Txt
	i_Investigation.txt	Txt
	m_MTBLS14481_LC-MS_alternating_normal-phase_v2_maf.tsv	Tabular
	s_MTBLS14481.txt	Txt

Items per page:

1 - 4 of 4

Similar Datasets

Mass spectrometry-based proteomic profiling of exosomal proteins in diabetic and non-diabetic ischemic stroke patients: a case-control study

Project description:This case-control study utilized mass spectrometry-based proteomics to compare exosomes from non-diabetic stroke (nDS=14), diabetic stroke (DS=13), and healthy control (HC=12) subjects. Among 1288 identified proteins, 387 were statistically compared. Statistical comparisons using a general linear model (log2 foldchange 0.58 and FDR-p0.05) were performed for nDS vs. HC, DS vs. HC, and DS vs. nDS. DS vs. HC and DS vs. nDS comparisons produced 155 and 159 differentially expressed proteins, respectively.

2024-06-03 | PXD047674 | Pride

Extracellular Vesicle miRNAs as Biomarkers of Asthma Severity

Project description:Asthma is a chronic lung disease with various clinical phenotypes, complicating its diagnosis and treatment. The micro-RNA (miRNA) profile of plasma-derived extracellular vesicles (EVs) may serve as potential circulating biomarkers for differentiating asthma phenotypes/endotypes. This study aims to characterize and compare the miRNA profiles in plasma-derived EVs across healthy controls (HC), non-severe asthmatics (NS), and severe asthmatics (SA). EVs were isolated from plasma samples of HC, NS, and SA, followed by physiochemical characterization and RNA isolation. Small RNA sequencing was performed, and differentially expressed (DE) miRNAs were identified through DESeq2 analysis. DE miRNAs and their predicted mRNA targets were identified using Ingenuity Pathway Analysis (IPA), and pathway enrichment was conducted using STRING DB and Enrichr. EVs from all groups were predominantly ~150-200 nm in size, with significantly higher EV counts in SA compared to HC and NS. miRNA expression analysis revealed unique and shared DE miRNAs across the three comparisons (HC vs. NS; HC vs. SA; NS vs. SA). A total of 16 unique DE miRNAs among these comparisons, between which in the NS vs. SA comparison, miR-515-3p positively correlates with lung function, and exacerbation and miR-133a-3p and miR-9-5p with ACT score. Target and pathway analyses from the NS vs. SA comparison indicated the enrichment of key pathways, including IL-4/IL-13, Th1, Th2, and Th17 cell differentiation, MAPK, PI3K-Akt, and receptor tyrosine kinase signaling. This study identified distinct miRNAs in plasma-derived EVs from NS vs. SA which could serve as potential circulating biomarkers for differentiating asthma severity.

2025-09-23 | GSE280322 | GEO

Dissecting the miRNome of psoriatic keratinocytes

Project description:Purpose: The purpose of this study was to identify the miRNome of keratinocytes in psoriasis Method: We performed next-generation sequencing for small RNAs from the RNA samples obtained from keratinocytes from psoriasis lesional, non-lesional and healthy skin. Next, we removed adapters and the low quality tags from the sequencing data and clean reads were mapped and aligned to known miRNAs sequences (miRBase 21). Novel miRNA transcripts were predicted based on the length (22-25 nucleotide) and secondary structure (precursor analysis) using MIREAP and mapped to the human genome. Data were normalized (transcripts per million, TPM) and analysed using Bioconductor-EdgeR. Group comparisons (lesional vs. healthy, lesional vs. non lesional and non-lesional vs. healthy) were performed. MiRNAs with <10% FDR, fold change >1.4 (1 TPM at least in one of the groups and expressed in half of the samples in any group) were considered statistically significant. Results: Robust expression of 411 known and 30 novel miRNAs (TPM > 1 in >50% of the samples in at least one of the groups) was detected in our samples. Using EdgeR we identified 104 miRNAs with significantly altered level (fold change > 1.4, FDR < 0.1) between healthy and psoriatic keratinocytes (P vs H). While, pair-wise comparison of miRNA expression in keratinocytes from non-lesional and lesional psoriasis skin (P vs. N) identified 87 deregulated miRNAs. Comparison of the miRNome of keratinocytes from non-lesional skin of psoriasis patients to healthy keratinocytes (N vs. H) identified 7 differentially expressed miRNAs. Conclusion: Here, for the first time we show the keratinocyte miRNome in psoriasis which may serve as the basis for future functional studies of miRNAs deregulated in keratinocytes in psoriasis.

2019-07-23 | GSE129373 | GEO

Roles and Programming of Arabidopsis ARGONAUTE Proteins During Turnip Mosaic Virus Infection

Project description:AGO protein immunoprecipitation was combined with high-throughput sequencing of associated small RNAs. AGO2, AGO10, and to a lesser extent AGO1 were shown to associate with siRNAs derived from silencing suppressor (HC-Pro)-deficient TuMV-AS9, but not with siRNAs derived from wild-type TuMV. Co-immunoprecipitation and small RNA sequencing revealed that viral siRNAs broadly associated with wild-type HC-Pro during TuMV infection. These results support the hypothesis that suppression of antiviral silencing during TuMV infection, at least in part, occurs through sequestration of virus-derived siRNAs away from antiviral AGO proteins by HC-Pro. Catalytic mutant HA-AGO1-DAH, HA-AGO2-DAD and HA-AGO10-DAH or catalytically active HA-AGO10-DDH were immunoprecipitated from buffer (mock) or inoculated rosette leaves (at 7 dpi) or noninoculated cauline leaves at 10 dpi with wt TuMV or suppressor-deficient TuMV-AS9. Inflorescence from TuMV infected plants was collected at 10 dpi with wt TuMV. HC-Pro was tagged with 6xHIS in TuMV-HIS and suppressor-deficient TuMV-HIS-AS9. HC-Pro was immunoprecipitated from noninoculated cauline leaves of inflorescence at 10 dpi. HC-Pro AS9 was immunoprecipitated from noninoculated cauline leaves at 15 dpi. Total RNA was extracted from input fraction and small RNAs separated by size fractionation. Small RNAs in input and HA-AGO or HC-Pro immunoprecipitation fractions were converted to DNA Amplicons by 5' (GUUCAGAGUUCUACAGUCCGACGAUC) or 3’ (CTGTAGGCACCATCAAT) adaptor ligation followed by RT-PCR. DNA Amplicons were sequenced using the Illumina HiSeq2000 platform. Duplicate libraries were made per treatment. For each library, hits to TuMV, to TuMV-HIS and to Arabidopsis thaliana were included in separate files.

2015-04-06 | E-GEOD-64911 | biostudies-arrayexpress

Gene expression profiling in Salmonella Typhimurium encountered with heterophils

Project description:To study the pathogenicity of Salmonella Typhimurium (ST) in heterophils, a whole Salmonella genome array was used to analyze RNA isolated from Salmonella in vitro encountered with heterophils (30 min, 1 h, 2 h, and 3 h) or medium control (NS). Dual-color, direct comparisons were carried out between heterophils-encountered ST and non-encountered controls (30 min vs. NS (30M/NS), 1 h vs. NS (1HR/NS), 2 h vs. NS (2HR/NS) and 3 h vs. NS (3HR/NS)). Each comparison includes four biological replicates. Out of 4588 genes on an array, there were 605, 758, 944 and 945 genes differentially expressed in the comparisons of 30M/NS, 1HR/NS, 2HR/NS and 3HR/NS, respectively (P < 0.001, fold-change > 2). Most of the Salmonella genes associated with invasion function were found differentially expressed at 2HR/NS and 3HR/NS comparisons. These candidate genes include TypeIII-secreted protein effector sopE2, Invasion proteins (e.g. invA, invE, invG, invH), and Invasion genes tranction activator hilA. The results of continuous transcriptional changes provide important information to elucidate the pathogenicity of ST in heterophils.

2011-01-01 | GSE16399 | GEO

Primary and ras keratinocytes plus TGFbeta1

Project description:We have compared the response to TGFbeta1 in normal and v-rasHa transduced primary mouse keratinocytes using NCI cDNA microarrays. This analysis reveals that Ha-ras alters global TGFbeta1 mediated gene expression in a gene specific manner. The expression pattern of TGFbeta1 immediate early response genes and down regulation of cell cycle control genes is not altered by Ha-ras but the induction of most extracellular matrix genes is blocked. Using Smad3 null keratinocytes, we find that the majority of TGFbeta1 responsive genes in primary keratinocytes are Smad3 dependent, but patterns of transcriptional responses suggest that the ability of Ha-ras to block TGFbeta1 mediated gene expression is not dependent on Smad3. However, the combination of oncogenic ras and loss of Smad3 prevents the TGFbeta1 dependent suppression of genes associated with cell cycle progression and apoptosis observed with either genotype alone. In addition several extracellular matrix genes are super-repressed by TGFbeta1 in the Ha-ras Smad3 null keratinocytes. These data provide a genomic framework for understanding how disruptions of TGFbeta signaling and oncogenic ras cooperate to promote premalignant progression of primary keratinocytes. Keywords: time series design

2008-12-02 | GSE3228 | GEO

Gene expression profiling in Salmonella Typhimurium stimulated heterophils using a chicken 44K Agilent microarray

Project description:To determine the host response to Salmonella Typhimurium (ST) in heterophils, a whole chicken genome array was used to analyze RNA isolated from heterophils stimulated in vitro with ST (30 min, 1 h, 2 h, and 3 h) or medium control (NS). Dual-color, direct comparisons were carried between ST-stimulated and non-stimulated controls (30 min vs. NS (30M/NS), 1 h vs. NS (1HR/NS), 2 h vs. NS (2HR/NS) and 3 h vs. NS (3HR/NS)). Each comparison includes four biological replicates. There were 2791, 3744, 12947 and 12482 genes differentially expressed in the comparisons of 30M/NS, 1HR/NS, 2HR/NS and 3HR/NS, respectively (P < 0.001) , while 50, 82, 153, and 146 genes were related to immune function, respectively. More than 80% of immune-related genes overlapped between the comparisons (30M/NS vs. 1HR/NS, 1HR/NS vs. 2HR/NS, and 2HR/NS vs. 3HR/NS). These candidate genes include cytokines (e.g. Interleukin (IL) 1β, -6, -10B and -12B), chemokines (e.g. IL-8, CCL4, K60 and K203) and cluster of differentiation (CD) markers (e.g. CD44, -47 and -83). A relatively large increase in the number of differentially expressed immune-related genes was observed between 1 h and 2 h post-stimulation. The results of continuous transcriptional change provide important information to elucidate both the cellular and molecular mechanisms of ST stimulation in chickens.

2010-04-13 | GSE14684 | GEO

Hydrocortisone and Triiodothyronine Regulate Hyaluronate Synthesis in a Tissue–Engineered Human Dermal Equivalent through Independent Pathways

Project description:Hydrocortisone (HC) and triiodothyronine (T3) have both been shown to be capable of independently inhibiting hyaluronate (HA, hyaluronic acid) synthesis in a self-assembled human dermal equivalent (human dermal matrix). We sought to investigate the action of these two hormones in concert on extracellular matrix formation and HA inhibition in a tissue engineered human dermal matrix.

2015-04-08 | GSE56616 | GEO

Expression data between migrating keratinocytes in diabetic mice against normal mice during re-epithelialization 3 days post wounding

Project description:During re-epithelialization, keratinocytes have to undergo specific gene expression changes that grant them increased motility. Diabetic keratinocytes have been observed to portray an impairment in this aspect. We used microarrays to identify the changes in the expression patterns of both normal and diabetic migrating keratinocytes during re-epithelialization.

2020-10-23 | GSE141956 | GEO

Circular RNA expression profiling and selection of key circular RNAs in the hypothalamus of heat-acclimated rats

Project description:Circular RNAs (circRNAs) play crucial roles in diverse biological processes. However, expression levels and functions of circRNAs related to heat acclimation (HA) are poorly understood. we, for the first time, used comprehensive circRNA expression profiling to investigate circRNA–miRNA interactions in HA rats, to provide a better understanding of mechanisms underlying HA. CircRNA expression profile was performed in rats’ hypothalamus of HA and control group with microarray assays. Bioinformatics analysis was conducted to predict their functions. And differential circRNAs and their regulated downstream miRNAs and mRNAs were quantitatively validated using real-time quantitative polymerase chain reaction (RT-qPCR ). Predicted proteins expression were determined using enzyme-linked immunosorbent assay (ELISA). In total, 53 circRNAs were differentially expressed between the HA and C group; 28 of these circRNAs were upregulated, while 25 were downregulated in HA (Fold change >1.5; P < 0.05). Three circRNAs and two miRNAs and three predicted mRNAs were obviously regulated after validated by RT-qPCR in HA rats. Two proteins expression were proportional to their mRNA changes. Further analysis indicated the circRNAs mostly close to HA were grouped into 3 signal pathways: including rno_circRNA_014301-vs-rno-miR-3575-vs-Hif-1α, rno_circRNA_014301-vs-rno-miR-3575-vs-Lppr4, rno_circRNA_010393-vs-rno-miR-20b-3p-vs-Mfap4 in hypoxia response pathways, substance/energy metabolism and inflammatory response pathways. Our findings implicate that many circRNAs regulate expressions of genes that interact with each other to exert their functions during HA.

2019-05-11 | GSE131044 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data