Trypanosoma brucei re-run
Ontology highlight
ABSTRACT:
REPOSITORIES: ENA
Similar Datasets
Project description:Sequencing of progeny from a Trypanosome brucei genetic crosses between T. brucei 247 and T. brucei 927
| PRJEB2011 | ENA
Project description:Sequencing of progeny from a Trypanosome brucei genetic crosses between T. brucei 247 and T. b. gambiense 386
| PRJEB2010 | ENA
Project description:Different strains of T. brucei induce different degrees of pathology in infected animals, and TREU927-infected mice display greater splenomegaly and anaemia than 247-infected mice. The analysis of differential host gene expression in infected spleens has allowed the identification of which pathways or processes are crucial in determining the progression of disease, for example IL10, LXR/RXR activation and alternative macrophage activation. We used microarray analysis to examine host gene expression between uninfected and infected mice, and between mice infected with the two trypanosome strains. Mouse spleens were dissected from infected or uninfected mice 10 days post infection, when the differences in pathology criteria (hepatomegaly, red blood cell numbers, reticulocyte percentage, IL10, IFNg and Il12 levels, and splenomegaly) were the greatest. This allowed a three-way comparison, uninfected vs 247-infected, uninfected vs 927-infected, and 247-infected vs 927-infected, allowing us to analyse genes that are differentially expressed between infected and uninfected spleens, but also crucially allows the differentiation between host gene expression with pathogenic (927) and less pathogenic (247) trypanosome strains.
2010-03-03 | E-GEOD-17049 | biostudies-arrayexpress
Project description:Different strains of T. brucei induce different degrees of pathology in infected animals, and TREU927-infected mice display greater splenomegaly and anaemia than 247-infected mice. The analysis of differential host gene expression in infected spleens has allowed the identification of which pathways or processes are crucial in determining the progression of disease, for example IL10, LXR/RXR activation and alternative macrophage activation. We used microarray analysis to examine host gene expression between uninfected and infected mice, and between mice infected with the two trypanosome strains.
2009-07-11 | GSE17049 | GEO
Project description:Genome sequencing of Trypanosoma brucei 927
| PRJEB2139 | ENA
Project description:The African trypanosome Trypanosoma brucei is a unicellular eukaryote, which relies on a protective Variant Surface Glycoprotein (VSG) coat for survival in the mammalian host. A single trypanosome has >2000 VSG genes and pseudogenes of which only one is expressed from one of ~15 telomeric bloodstream form expression sites (BESs). Infectious metacyclic trypanosomes present within the tsetse fly vector also express VSG from a separate set of telomeric metacyclic ESs (MESs). All MESs are silenced in bloodstream form T. brucei. As very little is known about how this is mediated, we performed a whole genome RNAi library screen to identify MES repressors. This allowed us to identify a novel SAP domain containing DNA binding protein which we called TbSAP. TbSAP is enriched at the nuclear periphery and binds both MESs and BESs. Knockdown of TbSAP in bloodstream form trypanosomes did not result in cells becoming more ‘metacyclic’-like. Instead, there was extensive global upregulation of transcripts including MES VSGs, VSGs within the silent VSG arrays as well as genes immediately downstream of BES promoters. TbSAP therefore appears to be a novel architectural chromatin protein playing an important role in silencing the extensive VSG repertoire of bloodstream form T. brucei.
2020-11-04 | GSE160713 | GEO
Project description:WGS of Trypanosoma brucei genetic crosses
| PRJEB2182 | ENA
Project description:Our trypanosome yeast two-hybrid prey library was made by random shotgun genomic cloning. NOT2, NOT10, NOT11 and CAF40 were used as baits to screen the library by mating. Diploid progeny were subjected to selection, resulting in between 100 and 800 surviving colonies, from which inserts were amplified and subjected to high-throughput sequencing. This is a Multiplex Library identified using the following primers: >CZ5468-Not1 CTCTACCCATCGAGCTCGAGCTACGTCAACG >CZ5472-ZC3H38 TCGGGACATCGAGCTCGAGCTACGTCAACG >CZ5473-Tb927_7_2780 GAATGAATCGAGCTCGAGCTACGTCAACG >CZ5474-Not11 TGACATCCATCGAGCTCGAGCTACGTCAACG. Yeast 2-hybrid Interactions for NOT10 (Tb927.10.8720), NOT11 (Tb927.8.1960), XAC1 (Tb927.7.2780) and ZC3H38 (Tb927.10.12800)
2022-01-14 | E-MTAB-4946 | biostudies-arrayexpress
Project description:Here, we produced a series of monomorphic trypanosome stocks, creating snapshots of the transition from pleomorphism to monomorphism, by continuous rapid syringe-passage in mice using a pleomorphic T. brucei. We then compared the transcriptomes of these artificial monomorphic trypanosomes, alongside several naturally monomorphic T. evansi and T. equiperdum strains, with the pleomorphic T. brucei, to analysis the causes of the monomorphism. Trypanosomes grown in mice were harvested at different stage post infection depend on strains (Detailed information was descrided in overall design), and mRNA profile of each sample was generated by deep sequencing, in triplicate.
2022-02-02 | GSE184265 | GEO