Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Transcriptomic profiling of three different neuroblastoma cell lines (CLB-BAR, CLB-GE and SK-N-AS) in response to ALK inhibition

ABSTRACT: Transcriptomic profiling of three different neuroblastoma cell lines (CLB-BAR, CLB-GE and SK-N-AS) in response to ALK inhibition

PROVIDER: PRJEB26451 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Similar Datasets

Transcriptomic profiling of three different neuroblastoma cell lines (CLB-BAR, CLB-GE and SK-N-AS) in response to ALK inhibition

Project description:Anaplastic Lymphoma Kinase (ALK) is a tyrosine kinase receptor which is a clinical target of major interest in cancer, including neuroblastoma. To better understand ALK signaling, three different neuroblastoma cell lines (CLB-BAR, CLB-GE and SK-N-AS) were cultured for 1hr and 24hrs in control conditions or after treatment with the ALK inhibitors crizotinib or lorlatinib. RNA-Seq experiments were performed to determine the expression changes resulting from ALK inhibition. Together with parallel phosphoproteomic experiments, these data unveil several important conserved oncogenic pathways in neuroblastoma.

2018-09-01 | E-MTAB-6654 | biostudies-arrayexpress

mRNA expression profiles of SK-N-AS neuroblastoma cells with induced ALK-wt, ALK-F1174L or ALK-R1275Q

Project description:Establishment of inducible SK-N-AS ALKwt, ALKF1174L and ALKR1275Q cell lines Human neuroblastoma SK-N-AS cells were electroporated with pcDNA6/TR (Invitrogen) using the NeonM-eM-( Transfection System (Life Techologies). Single cell clones were generated using blasticidin (7.5M-eM-5g/ml) and limited dilution. Using a TetR antibody (Clonetech), the clone with the highest TetR expression was selected (named SK-N-AS-TR) and used for the transfection with pT-REx-DEST30-ALK, ALKF1174L or ALKR1275Q. After transfection of SK-N-AS-TR with the ALK variants, single cell clones were raised using geneticin (500 M-eM-5g/ml) and limited dilution, while blasticidin treatment was continued as described above. Total RNA of (treated) cell lines, transgenic mice tumors and ganglia was isolated using the miRNeasy kit (Qiagen) according to the manufacturerM-^IM-[M-*s instructions, including on-column DNase treatment. Samples were labeled and hybridised to the Sureprint G3 human GE or G3 Mouse GE 8x60K microarrays (Agilent Technologies), according to the manufacturerM-^IM-[M-*s guidelines and starting from 200 ng of RNA.

2015-05-04 | E-MTAB-3207 | biostudies-arrayexpress

4C sequencing for the SOX11 promoter in the neuroblastoma cell lines CLB-GA, KELLY, SK-N-AS and SH-EP

Project description:4C sequencing for the SOX11 promoter in the neuroblastoma cell lines CLB-GA, KELLY, SK-N-AS and SH-EP.

2023-02-19 | E-MTAB-12580 | biostudies-arrayexpress

expression profiling data of CLB-GA neuroblastoma cells upon TAE-684, Crizotinib, X-396, LDK378, Trametinib, BEZ-235 and Vandetanib

Project description:Treatment of the CLB-GA cell line with complementary ALK, MEK, PI3K/mTOR or RET inhibitors (and DMSO (VWR) as control) was performed in duplicate for each drug using the GI50 concentrations (see further): 0.5M-k_M Crizotinib (Pfizer/Sigma-Aldrich); 0.06M-k_M X-396 (VWR); 0.2M-k_M LDK378 (Hoelzel Biotech); 0.05uM Trametinib (SelleckChem); 0.5M-k_M BEZ-235 (SelleckChem); 9.5M-k_M Vandetanib (SelleckChem). Cells were collected at 6h following treatment and further profiled. The selected inhibitor concentrations were used based on determined GI50 values. For generation of gene expression time series following ALK inhibition, CLB-GA cells were treated with 0.3uM TAE-684 (and DMSO as control treatment) and RNA was harvested at 0 M-^IM-[M-R 10M-^IM-[M-* M-^IM-[M-R 30M-^IM-[M-* M-^IM-[M-R 60M-^IM-[M-* M-^IM-[M-R 120M-^IM-[M-* M-^IM-[M-R 240M-^IM-[M-* M-^IM-[M-R 360M-^IM-[M-* time points. Samples were labeled and hybridised to the Sureprint G3 human GE or G3 Mouse GE 8x60K microarrays (Agilent Technologies), according to the manufacturerM-^IM-[M-*s guidelines and starting from 200 ng of RNA.

2015-05-04 | E-MTAB-3206 | biostudies-arrayexpress

Alteration of treatment of the ALK inhibitor in ALK-amplified neuroblastoma

Project description:Anaplastic Lymphoma Kinase (ALK) most frequently mutated in neuroblastoma (NB) and is atractive molecular target for therapy. However, efficacy of the ALK inhibitor against ALK-amplified NB is unclear. To elucidate genetic alterations induced by treatment of the ALK inhibitor, we compared expression profile between ALK inhibitor-treated and DMSO-treated NB39nu cells using Agilent SurePrint G3 Human GE 8x60K V2 Microarray Kit

2017-11-28 | GSE107354 | GEO

RNA-seq of human neuroblastoma cell lines treated with the ATR inhibitor BAY 1895344

Project description:To characterize the downstream gene expression response following ATR inhibition, we performed RNA-Seq after treatment of CLB-BAR and CLB-GE neuroblastoma cells with 50 nM of the ATR inhibitor BAY 1895344 for 24h and 48h

2021-10-21 | E-MTAB-10603 | biostudies-arrayexpress

Single cell RNA-Seq of Neuroblastoma cell line (CLB-berlud)

Project description:We report the application of single-molecule-based sequencing technology for high-throughput profiling of Neuroblastoma cell line (CLB-berlud) Examination of gene expression in Neuroblastoma cell line (CLB-berlud), as a negative control

2020-02-14 | GSE130022 | GEO

mRNA expression profiles of TAE-684 treated or shALK transfected neuroblastoma cell lines

Project description:Human wild-type ALK (SK-N-AS, NGP, IMR-32), ALKR1275Q (CLB-GA, LAN-5, UKF-NB-3), ALKF1174L (SK-N-SH, Kelly, SMS-KCNR) and ALK amplified (NB-1) neuroblastoma cell lines were treated in triplicate with 0.3M-k_M NPV-TAE-684 (Novartis/SelleckChem) or DMSO (VWR) for 6 hours, followed by RNA isolation and gene expression profiling. For shRNA mediated knockdown, pGIPZ-ALK shRNAmir and pGIPZ-non-silencing control shRNAmir vectors were used (Open Biosystems). The ALK shRNA was directed against a part of exon 26 in the tyrosine kinase domain of ALK (target sequence: TGGAAGGAATATTCACTTCTAA). Lentiviral particles were produced according to manufacturerM-^IM-[M-*s protocol (Open Biosystems). On day 2 post-transduction of neuroblastoma cells, the transduction efficiency was determined by flow cytometry and microscopic analysis of GFP-positive cells (>90% so no further selection was performed). Cells were subsequently harvested for expression profiling. Labeling of the RNA samples and hybridisation to the Affymetrix HG-U133plus2 arrays was performed using the manufacturerM-^IM-[M-*s protocol starting from 1 M-eM-5g of RNA.

2015-05-04 | E-MTAB-3205 | biostudies-arrayexpress

Trypanosoma cruzi CLB vs Trypanosoma rangeli and Trypanosoma conorhini

Project description:Comparative genomic analysis of T. cruzi CLB vs Trypanosoma rangeli (strains SC, Choachí, C23, H14, R1625 and PIT10) and Trypanosoma conorhini

2023-04-11 | GSE229354 | GEO

RNA-seq of human NSCL cell lines with induced fusion genes; ALK-EML4-V1, ALK-EML4-V3, ALK-TFG, ALK-KIF5B

Project description:To characterize the effects of common ALK fusion genes, we performed a comprehensive RNA-Seq analysis of NL20 cells induced with ALK-EML4-V1, ALK-EML4-V3, ALK-TFG, ALK-KIF5B, using Doxycycline

2022-12-18 | E-MTAB-11304 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data