Klebsiella pneumoniae
Ontology highlight
ABSTRACT:
PROVIDER: PRJEB30679 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Elucidating the RamA Regulon in Klebsiella pneumoniae and the transcriptome profiles of multidrug resistant Klebsiella pneumoniae Overall design: various strains of Klebsiella pneumoniae
2017-12-25 | GSE24688 | GEO
Project description:Klebsiella pneumoniae is a major threat to public health, causing significant morbidity and mortality worldwide. The emergence of highly drug-resistant strains is particularly concerning. There has been a recognition and division of Klebsiella pneumoniae into three distinct phylogenetic groups: Klebsiella pneumoniae, Klebsiella variicola, and Klebsiella quasipneumoniae. K. variicola and K. quasipneumoniae have often been described as opportunistic pathogens that have less virulence in humans than K. pneumoniae does. We recently sequenced the genomes of 1,777 extended-spectrum-beta-lactamase (ESBL)-producing K. pneumoniae isolates recovered from human infections and discovered that 28 strains were phylogenetically related to K. variicola and K. quasipneumoniae. Whole-genome sequencing of 95 additional non-ESBL-producing K. pneumoniae isolates recovered from patients found 12 K. quasipneumoniae strains. Matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) analysis initially identified all patient isolates as K. pneumoniae, suggesting a potential pitfall in conventional clinical microbiology laboratory identification methods. Whole-genome sequence analysis revealed extensive sharing of core gene content and plasmid replicons among the Klebsiella species. For the first time, strains of both K. variicola and K. quasipneumoniae were found to carry the Klebsiella pneumoniae carbapenemase (KPC) gene, while another K. variicola strain was found to carry the New Delhi metallo-beta-lactamase 1 (NDM-1) gene. K. variicola and K. quasipneumoniae infections were not less virulent than K. pneumoniae infections, as assessed by in-hospital mortality and infection type. We also discovered evidence of homologous recombination in one K. variicola strain, as well as one strain from a novel Klebsiella species, which challenge the current understanding of interrelationships between clades of Klebsiella. IMPORTANCEKlebsiella pneumoniae is a serious human pathogen associated with resistance to multiple antibiotics and high mortality. K. variicola and K. quasipneumoniae are closely related organisms that are generally considered to be less-virulent opportunistic pathogens. We used a large, comprehensive, population-based strain collection and whole-genome sequencing to investigate infections caused by these organisms in our hospital system. We discovered that K. variicola and K. quasipneumoniae isolates are often misidentified as K. pneumoniae by routine clinical microbiology diagnostics and frequently cause severe life-threatening infections similar to K. pneumoniae. The presence of KPC in K. variicola and K. quasipneumoniae strains as well as NDM-1 metallo-beta-lactamase in one K. variicola strain is particularly concerning because these genes confer resistance to many different beta-lactam antibiotics. The sharing of plasmids, as well as evidence of homologous recombination, between these three species of Klebsiella is cause for additional concern.
2017-01-01 | S-EPMC5541162 | BioStudies
Project description:Total RNA isolated from mid log grown cultures of K.pneumoniae and mutant strain in three independent times.Expression profile of K.pneumoniae and its RND muatant was compared. Overall design: Agilent one-color experiment,Organism: Klebsiella pneumoniae ,Agilent Custom Klebsiella pneumoniae 8x15k Microarray designed by Genotypic Technology Private Limited (AMADID: 079362)
| GSE89564 | GEO
Project description:Klebsiella pneumoniae is a Gram-negative, rod-shaped, nonmotile, and opportunistic pathogenic species with clinical importance. It is a part of natural flora of humans and animals. Here we report the draft genome sequence of the type strain of Klebsiella pneumoniae subsp. pneumoniae (DSM 30104(T)) to provide taxonomic and functional insights into the species.
2012-01-01 | S-EPMC3458660 | BioStudies
Project description:To investigate the whole-genome gene expression difference between the wild-type and capsule deletion mutant in Klebsiella pneumoniae MGH 78578. The mutants analyzed in this study are further described in Huang T.W., Stapleton J.C., Chang H.Y., Tsai S.F., Palsson B.O., Charusanti P. Capsule removal via lambda-Red knockout system perturbs biofilm formation and fimbriae extression in Klesiella pneumoniae MGH 78578 (manuscript submission) A six chip study using total RNA recovered from three separate wild-type cultures and three separate cultures of a capsule deltion mutant of Klebsiella pneumoniae MGH 78578. The capsule gene cluster (KPN_02493 to KPN_02515) was entirely removed in the capsule deletion mutant. Each chip measures the expression level of 5,305 genes from Klebsiella pneumoniae MGH 78578 and the associated five plasmids (pKPN3, pKPN4, pKPN5, pKPN6 and pKPN7) with 50-mer oligo tiling array with 30-mer spacer.
2013-12-31 | E-GEOD-40011 | ArrayExpress
Project description:Total RNA isolated from mid log grown cultures of K.pneumoniae and mutant strain in three independent times.Expression profile of K.pneumoniae and its pk muatant was compared. Overall design: Agilent one-color experiment,Organism: Klebsiella pneumoniae ,Agilent Custom Klebsiella pneumoniae 8x15k Microarray designed by Genotypic Technology Private Limited (AMADID: 079362)
| GSE89566 | GEO
Project description:Listeria monocytogenes can cause serious infection and recently, relapse of listeriosis has been reported in leukemia and colorectal cancer, and the patients with Klebsiella pneumoniae are at increased risk of colorectal cancer. Translation initiation codon recognition is basically mediated by Shine-Dalgarno (SD) and the anti-SD sequences at the small ribosomal RNA (ssu rRNA). In this research, Shine-Dalgarno sequences prediction in Listeria monocytogenes La111 and Klebsiella pneumoniae KCTC 2242 was investigated. The whole genomic sequence of Listeria monocytogenes La111 and Klebsiella pneumoniae KCTC 2242 were retrieved from http://www.ncbi.nlm.nih.gov/ (Listeria monocytogenes La111 NCBI Reference sequence: NC_020557; Klebsiella pneumoniae KCTC 2242 NCBI Reference sequence: CP002910) in order to be analyzed with DAMBE software and BLAST. The results showed that the consensus sequence for Klebsiella pneumoniae KCTC 2242 was CCCCCCCUCCCCCUCCCCCUCCUCCUCCUUUUUAAAAAAGGGGAAAAACC and for Listeria monocytogenes La111 was CCCCCCCUCCCCCUUUCCCUCCUAUUCUUAUAAAAGGGGG-GGGGUUCAC. The PSD was higher in Listeria monocytogenes La111 compared to Klebsiella pneumoniae KCTC 2242 (0.9090> 0.8618). The results showed that Nm in Listeria monocytogenes La111 was higher than Klebsiella pneumoniae KCTC 2242 (4.5846> 4.4862). Accurate characterization of SD sequences may increase our knowledge on how an organism's transcriptome is related to its cellular proteome.
2014-01-01 | S-EPMC3927391 | BioStudies
Project description:We report the emergence of colistin resistance in Klebsiella pneumoniae carbapenemase (KPC)-producing Klebsiella pneumoniae after 8 days of colistin-based therapy, resulting in relapse of bloodstream infection and death. Disruption of the mgrB gene by insertion of a mobile genetic element was found to be the mechanism, which was replicated in vitro after exposure to subinhibitory concentrations of colistin and meropenem.
2018-01-01 | S-EPMC5913667 | BioStudies
Project description:Klebsiella pneumoniae is a Gram-negative opportunistic pathogen and a leading cause of antibiotic-resistant nosocomial infections. The genome sequence of siphophage Skenny, which infects K. pneumoniae, is described here. Skenny encodes 78 genes and is closely related to Klebsiella phages KPN N141 and MezzoGao, which are T1-like phages.
2019-01-01 | S-EPMC6763657 | BioStudies
Project description:Klebsiella pneumoniae is an opportunistic pathogen associated with hospital-acquired infections. This report describes the complete genome of the K. pneumoniae myophage Mulock, which appears to be a temperate myophage distantly related to other Klebsiella myophages in morphogenesis genes and is partially syntenic with the canonical Escherichia phage lambda in genes encoding lambda-like functions.
2019-01-01 | S-EPMC6856289 | BioStudies