Improved genome-wide mapping of uncapped and cleaved transcripts in eukaryotes—GMUCT 2.0
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA203678 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:The advent of high-throughput sequencing has led to an explosion of studies into the diversity, expression, processing, and lifespan of RNAs. Recently, three different high-throughput sequencing-based methods have been developed to specifically study RNAs that are in the process of being degraded. All three methods—genome-wide mapping of uncapped and cleaved transcripts (GMUCT), parallel analysis of RNA ends (PARE), and degradome sequencing—take advantage of the fact that Illumina sequencing libraries use T4 RNA ligase 1 to ligate an adapter to the 5’ end of RNAs that have a free 5’-monophosphate. This condition for T4 RNA ligase 1 substrates means that mature mRNAs are not substrates of the enzyme because they have a 5’-cap. As a result, these sequencing libraries are specifically made up of clones of decapped or degrading mRNAs and the 3’ fragment of cleaved miRNA and siRNA targets. In this paper, we present a massively streamlined protocol for GMUCT that takes 2-3 days and can be initiated with as little as 5 µg of starting total RNA and involves only one gel size-selection step. We show that the results are similar to libraries made using the previous GMUCT protocol and PARE. GMUCT libraries were made from flower buds of the Arabidopsis thaliana accession Columbia (Col-0) and three human cell lines—the cervical cancer cell line HeLa, human embryonic kidney 293 T (HEK293T) cell line, and the human chronic myelogenous leukaemia cell line K562—two replicates of each. Matched mRNA-seq libraries were made for each Col-0 GMUCT replicate. These libraries were sequenced on the Illumina HiSeq 2000 and the reads were trimmed to remove the adapter sequences (TGGAATTCTCGGGTGCCAAGGAACTCCAGTCA). The abundance of each unique read was determined, and unique reads were mapped to the Arabidopsis and human genomes, respectively.
2014-03-08 | E-GEOD-47121 | biostudies-arrayexpress
Project description:The advent of high-throughput sequencing has led to an explosion of studies into the diversity, expression, processing, and lifespan of RNAs. Recently, three different high-throughput sequencing-based methods have been developed to specifically study RNAs that are in the process of being degraded. All three methods—genome-wide mapping of uncapped and cleaved transcripts (GMUCT), parallel analysis of RNA ends (PARE), and degradome sequencing—take advantage of the fact that Illumina sequencing libraries use T4 RNA ligase 1 to ligate an adapter to the 5’ end of RNAs that have a free 5’-monophosphate. This condition for T4 RNA ligase 1 substrates means that mature mRNAs are not substrates of the enzyme because they have a 5’-cap. As a result, these sequencing libraries are specifically made up of clones of decapped or degrading mRNAs and the 3’ fragment of cleaved miRNA and siRNA targets. In this paper, we present a massively streamlined protocol for GMUCT that takes 2-3 days and can be initiated with as little as 5 µg of starting total RNA and involves only one gel size-selection step. We show that the results are similar to libraries made using the previous GMUCT protocol and PARE.
2014-03-08 | GSE47121 | GEO
Project description:We were interested in identifying targets of novel putative miRNAs we identified from small RNA sequencing libraries of Arabidopsis shoots. The small RNA (smRNA) sequencing libraries were made to identify changes in abundance of specific smRNAs in response to developmental transitions in Arabidopsis thaliana shoots, with special focus on vegetative phase change. We specifically wanted to separate the temporal changes in gene expression that result from vegetative phase change and those from flowering. Because of the close timing between the juvenile-to-adult and adult-to-reproductive developmental transitions in Arabidopsis grown under long day conditions, we used the late-flowering genotype FRI;FLC developed by the lab of Richard Amasino by introgressing the FRI allele from Sf-2 into the Col-0 genetic background, which is fri;FLC. For the early flowering genotype, we used FRI;flc-3, also developed by the Amasino lab by EMS-mutagenizing FRI;FLC, identifying early flowering mutants, and backcrossing multiple times to eliminate other EMS-induced mutations. The onset of vegetative phase change in FRI;FLC and FRI;flc-3 under our growth conditions was identical, but the progression was slower in FRI;FLC. By sequencing small RNAs from shoot apices at different time points and fully-expanded leaves at different positions on the shoot and comparing the results between the two genotypes, we were able to obtain a clear picture of changes in small RNA abundance in response to vegetative phase change and flowering in Arabidopsis. We then used the remaining RNA to make genome-wide mapping of uncapped and cleaved transcripts (GMUCT) 2.0 libraries of a subset of our samples. GMUCT 2.0 allows you to identify RNAs that are 1) uncapped and in the process of 5’->3’ exonuclease degradation and 2) miRNA and siRNA-mediated cleavage products. We wanted to use these GMUCT 2.0 libraries to identify targets of novel putative miRNAs discovered by our smRNA sequencing, thereby supporting the idea that these novel putative miRNAs are in fact functional.
2016-02-01 | GSE72505 | GEO
Project description:Fragmentation ion spectral analysis of chemically crosslinked proteins is an established technology in the proteomics research repertoire for determining protein interactions, spatial orientation, and structure. Here we present Kojak version 2.0, a major update to the original Kojak algorithm, which was developed to identify crosslinked peptides from fragment ion spectra using a database search approach. A substantially improved algorithm with updated scoring metrics, support for cleavable crosslinkers, and identification of crosslinks between 15N-labeled homomultimers are among the newest features of Kojak 2.0 presented here. Kojak 2.0 is now integrated into the Trans-Proteomic Pipeline, enabling access to dozens of additional tools within that suite. In particular, the PeptideProphet and iProphet tools for validation of crosslinks improve the sensitivity and accuracy of correct crosslink identifications at user-defined thresholds. These new features improve the versatility of the algorithm, enabling its use in a wider range of experimental designs and analysis pipelines. Kojak 2.0 remains open-source and multi-platform.
2023-01-18 | PXD037492 | Pride
Project description:Positional proteomics methodologies have transformed protease research and have brought mass spectrometry (MS)-based degradomics studies to the forefront of protease characterization and system-wide interrogation of protease signaling. Considerable advancements in sensitivity and throughput of liquid chromatography (LC)-MS/MS instrumentation enable generation of enormous positional proteomics datasets of protein termini and neo-termini of cleaved protease substrates. However, such progress has not been observed to the same extent in data analysis and post-processing steps, which arguably constitute the largest bottleneck in positional proteomics workflows. Here, we present a computational tool, CLIPPER 2.0, that builds on prior algorithms developed for MS-based protein termini analysis, facilitating peptide level annotation and data analysis. CLIPPER 2.0 can be used with several sample preparation workflows and proteomics search algorithms, and enables fast and automated database information retrieval, statistical and network analysis, as well as visualization of terminomic datasets. We demonstrate our tool by analyzing GluC and MMP9 cleavages in HeLa lysates. CLIPPER 2.0 is available at https://github.com/UadKLab/CLIPPER-2.0.
2024-05-02 | PXD047261 | Pride
Project description:Using 3' RACEseq method, we compared the tailing and nibbling patterns of RISC-cleaved MYB33 and SPL13 transcripts between wild-type plants and mutant plants depleted for the terminal uridylyltransferases (TUTases) HESO1 and URT1. Our data reveal a major and minor role for HESO and URT1, respectively, in the uridylation of RISC-cleaved transcripts.
2018-10-05 | GSE115470 | GEO
Project description:In order to gain insight into relative stability of transcripts in plants that lacked m6A, we performed global mapping of uncapped and cleaved transcripts
2018-11-09 | GSE108766 | GEO
Project description:RNA turnover is necessary for controlling proper mRNA levels post-transcriptionally. In general, RNA degradation is via exoribonucleases that degrade RNA either from the 5’ end to the 3’ end, such as XRN4, or in the opposite direction by the multi-subunit exosome complex. Here, we use genome-wide mapping of uncapped and cleaved transcripts to reveal the global landscape of co-translational mRNA decay in the Arabidopsis thaliana transcriptome. We found that this process leaves a clear three nucleotide periodicity in open reading frames. This pattern of co-translational degradation is especially evident near the ends of open reading frames, where we observe accumulation of cleavage events focused 16 to 17 nucleotides upstream of the stop codon because of ribosomal pausing during translation termination. Following treatment of Arabidopsis plants with the translation inhibitor cycloheximide, cleavage events accumulate 13 to 14 nucleotides upstream of the start codon where initiating ribosomes have been stalled with these sequences in their P site. Further analysis in xrn4 mutant plants indicates that co-translational RNA decay is XRN4-dependent. Additionally, studies in plants lacking CAP-BINDING PROTEIN80/ABA HYPERSENSITIVE1, the largest subunit of the nuclear mRNA cap-binding complex, reveal a role for this protein in co-translational decay. In total, our results demonstrate the global prevalence and features of co-translational RNA decay in a plant transcriptome.
2016-09-30 | GSE71913 | GEO
Project description:AffymetrixHuman Gene 2.0 ST Array
| PRJNA478427 | ENA
Project description:Genebank 2.0 - Resistance gene capture in winter wheat diversity panel
| PRJEB48219 | ENA