Ontology highlight
ABSTRACT:
PROVIDER: PRJNA260627 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:HOTAIR lentiviral infected prostate cancer cells
| PRJNA260629 | ENA
Project description:HOTAIR or shHOTAIR lentiviral infected prostate cancer cells [ChIP-Seq]
| PRJNA260625 | ENA
Project description:LNCaP prostate cancer cells were infected by lentivirus expressing either ctrl or HOTAIR, and the cells were cultured in hormone-deprived condition (Ethl) or in the presence of androgen (R1881). C4-2B prostate cancer cells were infected by lentivirus expressing either shCtrl or shHOTAIR, and the cells were cultured in hormone-deprived condition (Ethl) or in the presence of androgen (R1881).
2015-10-01 | GSE61268 | GEO
Project description:LNCaP prostate cancer cells were infected by lentivirus expressing either ctrl or HOTAIR. The cells were cultured either in hormone-deprived condition (Ethl) or in the presence of androgen( R1881).
2015-10-01 | GSE61269 | GEO
Project description:MDA-MB-231 Breast Cancer Cells were infected by retroviral expression with either VECTOR or HOTAIR. To test the role of polycomb in HOTAIR mediated gene expression, MDA-MB-231 HOTAIR cells were infected with short hairpin retroviral vectors targeting SUZ12 or EZH2. A genetic modification design type is where an organism(s) has had genetic material removed, rearranged, mutagenized or added, such as knock out.
2010-04-15 | GSE20435 | GEO
Project description:MDA-MB-231 Breast Cancer Cells were infected by retroviral expression with either VECTOR or HOTAIR. To test the role of polycomb in HOTAIR mediated gene expression, MDA-MB-231 HOTAIR cells were infected with short hairpin retroviral vectors targeting SUZ12 or EZH2. A genetic modification design type is where an organism(s) has had genetic material removed, rearranged, mutagenized or added, such as knock out. genetic_modification_design
2010-04-15 | E-GEOD-20435 | biostudies-arrayexpress
Project description:Short hairpin RNA library-based functional screening identified ribosomal protein L31 that modulates prostate cancer cell growth Vehicle vs. bicalutamide treated LNCaP cells infected with lentiviral shRNA library. Biological replicates: 2 vehicle treatments, 2 bicalutamide treatments.
2015-05-15 | E-GEOD-60382 | biostudies-arrayexpress
Project description:Analysis of gene expresssion altered upon knockdown of histone demethylase JMJD1A in human prostate cancer cells. The objective is to elucidate the transcriptional programs that are controlled by JMJD1A in human prostate cancer. CWR22Rv1 prostate cancer cells were transduced with lentiviral particles encoding control pLKO.1 or JMJD1A shRNA (shJMJD1A). After 48 h, total RNAs were collected for the microarray analysis to determine the differentially expressed genes between Rv1 pLKO.1 and Rv1 shJMJD1A samples.
2015-09-08 | E-GEOD-70498 | biostudies-arrayexpress
Project description:Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after infection and gene expression profiling was performed. Among genes downregulated were many well characterized androgen regulated genes. LNCaP cells logarthmically growing in full serum was infected with three different shRNA lentiviruses. Three days after infection
2013-05-10 | E-GEOD-46329 | biostudies-arrayexpress