Defensive effect of microRNA-200b/c against amyloid-beta peptide-induced toxicity in Alzheimer’s disease models
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA412881 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:MiRNA molecules are important post-transcriptional regulators of gene expression in the brain function. Altered miRNA profiles could represent a defensive response against the pathogenesis of neurodegenerative disorders, such as Alzheimer's disease (AD). Endogenous miRNAs have lower toxic effects than other gene silencing methods, thus enhancing the expression of defensive miRNA could be an effective therapy. However, little is known about the potential of targeting miRNAs for the treatment of AD. Here, we examined the function of the miR-200 family (miR-200a, -141, -429, -200b, -200c), identified using miRNA microarray analysis of cortical tissue from Tg2576 transgenic mice. In murine primary neurons, we found that upregulation of miR-200b or -200c was induced by the addition of amyloid beta (Aβ). Neurons transfected with miR-200b or -200c reduced secretion of Aβ in conditioned medium. Moreover, mice infused with miR-200b/c into the brain were relieved of memory impairments induced by intracerebroventricular injection of oligomeric Aβ, and demonstrated proper spatial learning in the Barnes maze. To gain further understanding of the relationship between miR-200b/c and Aβ, we identified target mRNAs via an RNA-binding protein immunoprecipitation-microarray assay. Western blot analysis showed that expression of ribosomal protein S6 kinase B1 (S6K1), a candidate target, was inhibited by miR-200c. S6K1, a downstream effector of mammalian target of rapamycin (mTOR), serves as a negative feedback mediator that phosphorylates insulin receptor substrate 1 at serine residues (IRS-1pSer). S6K1-dependent IRS-1pSer suppresses insulin signaling leading to insulin resistance, which is frequently observed in AD brains. Notably, miR-200b/c transfection of SH-SY5Y cells reduced the levels of IRS-1pSer. This finding indicates that miR-200b/c has the potential to alleviate insulin resistance via modulation of S6K1. Taken together, miR-200b/c may contribute to reduce Aβ secretion and Aβ-induced cognitive impairment by promoting insulin signaling.
2018-05-08 | GSE104514 | GEO
Project description:Alzheimer’s Disease (AD) is the most common form of dementia and a leading global cause of human mortality and morbidity. Amyloid plaques of the amyloid beta (Aß) peptide are a universal pathological hallmark of AD and rare mutations in Aß can cause familial forms of AD (fAD). However, hundreds of additional mutations in Aß of uncertain significance are likely to exist in the human population, making clinical interpretation of genetic variation a difficult challenge even in this short peptide. Here, we use deep mutagenesis to quantify the effects of all possible single nucleotide variants and thousands of double mutations on the ability of Aß to nucleate amyloid fibrils in vivo. This data provides the first comprehensive view of how mutations alter the nucleation of an amyloid, reveals a modular organisation of mutational effects in Aß, and demonstrates the importance of charge in preventing nucleation. Moreover, the in vivo nucleation data, unlike computational predictors, accurately discriminates the known dominant fAD mutations. These results illustrate how deep mutagenesis can be used to genetically validate assays as discovery platforms. They also further prioritize nucleation as the critical biochemical event to target in order to prevent and treat AD.
2021-02-02 | GSE151147 | GEO
Project description:We report high-affinity ssDNA aptamers as biomarkers and antagonists of amyloid-β peptide. We generated three novel aptamer sequences from the pool of aptamers through the SELEX process, and evaluated their affinity and sensitivity using enzyme-linked immunosorbent assay (ELISA). (The forward primer: ATTAGTCAAGAGGTAGACGCACATA, reverse primer TTCTGGTCGTCGTGACTCCTAT) The ssDNA aptamers modeled into a three-dimensional structure; interaction and mechanism of action derived through molecular dynamics simulations (MD). MD simulations revealed the nature of binding and inhibition of aggregation by binding with amyloid-β peptide monomers, dimers, and other oligomers. The presence of high non-bonded interaction energy along with hydrogen bonds constitutes the complex structure of the aptamer-amyloid-β peptide. Furthermore, the changes in the secondary structure induced by aptamers may help remove the peptide through the blood-brain barrier. This study provided a framework for the application of aptamers against amyloid-β peptides as biomarkers and antagonists.
2019-09-30 | GSE124865 | GEO
Project description:Cortical type-I astrocytes were cultured on the beta-amyloid peptide 25-35 fragment for 12hr, 1d, 3d, and 5d.
2007-10-12 | E-GEOD-856 | biostudies-arrayexpress
Project description:Transgenic animals were engineered to express human amyloid peptide controlled by a muscle-specific, heat-inducible promoter. At low temperatures (16°C) Abeta expression is minimal, while at higher temperatures (20-25°C) Abeta accummulates in large quantities and causes paralysis. GFP- and GFP::degron (a toxic aggregating GFP mutant)-expressing animals were used as controls. Animals were grown at 16°C till early 3rd larval stage and then upshifted to 25°C. Animals were harvested at the time of upshift (T0), and every 4 hours later until 20 hours postupshift (T4-T20).
2015-02-12 | E-GEOD-65851 | biostudies-arrayexpress
Project description:Alzheimer’s disease is the most common form of dementia and is associated with the accumulation of amyloid peptide β in the brain parenchyma. Vascular damage and microvascular thrombosis contribute to the neuronal degeneration and the loss of brain function typical of this disease. In this study, we utilised a murine model of Alzheimer’s disease to evaluate the neurovascular effects of this disease. Upon detection of an increase in the phosphorylation of the endothelial surface receptor VE-cadherin, we focused our attention on endothelial cells.
2022-05-19 | PXD030300 | Pride
Project description:Transgenic animals were engineered to express human amyloid peptide controlled by a muscle-specific, heat-inducible promoter. At low temperatures (16°C) Abeta expression is minimal, while at higher temperatures (20-25°C) Abeta accummulates in large quantities and causes paralysis. GFP- and GFP::degron (a toxic aggregating GFP mutant)-expressing animals were used as controls.
2015-02-12 | GSE65851 | GEO
Project description:Amyloid-beta (Aβ)-induced neurotoxicity is a major contributor to the pathologies associated with Alzheimer’s disease (AD). The formation of reactive oxygen species (ROS), and early response induced by the Aβ peptide, plays a significant role in effecting cellular pathogenesis. Here we apply a particularly effective form of exogenous Aβ, i.e., amyloid beta-derived diffusible ligands (ADDLs), to cultured primary cortical/hippocampal neurons to elicit ROS and drive cellular dysfunction. To prevent and even reverse such effects, we employed a cell-penetrating, peroxisome-targeted, protein biologic - called CAT-SKL. We show the recombinant enzyme enters neurons, reverses Aβ-induced oxidative stress, and increases cell viability. Dramatic restorative effects on damaged neuronal processes were also observed. CAT-SKL, a targeted antioxidant, may represent a new therapeutic approach for treatment disorders, like Alzheimer’s disease, where oxidative stress is manifest. Preclinical testing is warranted and ongoing Primary Rat E18 coritical/hippocampal neurons (derived from Sprague Dawley E18 cortical/hippocampus tissue obtained from BrainBits®, Springfield, IL) were treated with ADDLs in the presence or absence of the targeted antioxidant CAT-SKL to investigate genes that displayed altered expression in response to treatmetns total RNA was isolated and analyzed in an Agilent two-color experiment. Two biological replicates of each condition were directly compared, ratios are treated relative to control (untreated)
2014-04-11 | E-GEOD-55369 | biostudies-arrayexpress
Project description:MALDI mass spectrometry imaging (MSI) enables label-free, spatially resolved analysis of a wide range of analytes in tissue sections. Quantitative analysis of MSI datasets is typically performed on single pixels or manually assigned regions of interest (ROI). However, many sparse, small objects such as Alzheimer’s disease (AD) brain deposits of amyloid peptides called plaques are neither single pixels nor ROI. Here, we propose a new approach to facilitate comparative computational evaluation of amyloid plaque-like objects by MSI: a fast PLAQUE PICKER tool that enables statistical evaluation of heterogeneous amyloid peptide composition. Comparing two AD mouse models, APP NL-G-F and APP PS1, we identified distinct heterogeneous plaque populations in the NL-G-F model, but only one class of plaques in the PS1 model. We propose quantitative metrics for the comparison of technical and biological MSI replicates.
2020-10-15 | PXD020824 | Pride
Project description:Clusterin (CLU) is one of the most significant genetic risk factors for late onset Alzheimer’s disease. Numerous studies have now demonstrated that CLU-AD mutations and amyloid-β (Aβ) treatment alter the trafficking and localisation of glycosylated CLU. iPSCs with altered CLU trafficking were generated following the removal of CLU exon 2 by CRISPR/Cas9 gene editing. Neurons were generated from control, unedited and exon 2 -/- iPSCs and were incubated with aggregated Aβ peptides. Changes in cell death and neurite length were quantified to determine if altered CLU protein trafficking influenced neuronal sensitivity to Aβ.
2022-07-05 | GSE207466 | GEO