SYK activity modulates the EGFR-dependent transcriptome
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA417718 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Background: Among all gynecologic malignancies, epithelial ovarian cancer has the highest case-to-fatality ratio. Most patients are diagnosed at advanced stages and recurrence is common and accounts for disease-related mortality. Spleen tyrosine kinase (SYK) is an emerging cancer-associated kinase upregulated in recurrent tumors and is amenable for inhibition using small compounds that have been studied in clinical trials for autoimmune diseases. Our previous proteomic analysis identified several novel SYK substrates including EGFR and ERBB2. Here, we investigated the cross-talk between these pathways in ovarian carcinomas. Methods: Immunohistochemistry and immunoblotting were utilized to assess SYK and EGFR phosphorylation in ovarian serous carcinomas. Association with survival was determined by Kaplan-Meier analysis and the log-rank test. To study its role in EGFR signaling, SYK activity was modulated using a small molecule inhibitor, a syngeneic knockout, and an active kinase inducible system. We applied RNA-seq to investigate the SYK-regulated EGF-induced transcriptome. Results: Intense immunoreactivity of active pSYK(Y525/526) correlated with poor overall survival in two independent ovarian cancer cohorts. SYK directly phosphorylated EGFR and ERBB2, while knockout of SYK reduces their phosphorylation. Phosphorylation levels of SYK(Y525/526) positively correlated with EGFR(Y1187) and STAT3(Y705). Active SYK reduced sensitivity to the EGFR/ERBB2 inhibitor, lapatinib, and SYK non-phosphorylatable EGFR mutant was more sensitive to paclitaxel. SYK modulated the EGF-induced transcriptome, supporting its involvement in EGFR/ERBB2-regulated transcriptional activity. Conclusions: Our findings suggest an upstream role of SYK in regulating the EGFR/ERBB2 signaling, and provide a biological rationale for targeting SYK in ovarian cancer therapy.
2020-11-08 | GSE106716 | GEO
Project description:The PI3K-AKT pathway is known to regulate cytokines in dust mite-induced pediatric asthma. However, the underlying molecular steps involved are not clear. In order to clarify further the molecular steps, this study investigated the expression of certain genes and the involvement of miRNAs in the PI3K-AKT pathway, which might affect the resultant cytokine-secretion. In-vivo and in-vitro ELISA, qRT-PCR, western-blot and microarrays analyses were used in this study. A down-expression of miRNA-27b-3p in dust mite induced asthma group (group D) was found by microarray analysis. This was confirmed by qRT-PCR that found the miRNA-27b-3p transcripts that regulated the expression of SYK and EGFR were also significantly decreased (p < 0.01) in group D. The transcript levels of the SYK and PI3K genes were higher, while those of EGFR were lower in the former group. Meanwhile, we found significant differences in plasma concentrations of some cytokines between the dust mite-induced asthma subjects and the healthy controls. On the other hand, this correlated with the finding that the transcripts of SYK and its downstream PI3K were decreased in HBE transfected with miRNA-27b-3p, but were increased in HBE transfected with the inhibitor in vitro. Our results indicate that the differential expression of the miRNAs in dust mite-induced pediatric asthma may regulate their target gene SYK and may have an impact on the PI3K-AKT pathway associated with the production of cytokines. These findings should add new insight into the pathogenesis of pediatric asthma.
2018-09-20 | GSE120172 | GEO
Project description:Genetic studies have highlighted microglia as pivotal in orchestrating Alzheimer’s disease (AD). Microglia that adhere to Aβ plaques acquire a transcriptional signature, “diseaseassociated microglia” (DAM), which largely emanates from the TREM2-DAP12 receptor complex that transmits intracellular signals through the protein tyrosine kinase SYK. The human TREM2R47H variant associated with high AD risk fails to activate microglia via SYK. We found that SYK-deficient microglia cannot encase Aβ plaques, accelerating brain pathology and behavioral deficits. SYK deficiency impaired the PI3K-AKT-GSK3β-mTOR pathway, incapacitating anabolic support required for attaining the DAM profile. However, SYK-deficient microglia proliferated and advanced to an Apoe-expressing prodromal stage of DAM; this pathway relied on the adaptor DAP10, which also binds TREM2. Thus, microglial responses to Aβ involve non-redundant SYK- and DAP10-pathways. Systemic administration of an antibody against CLEC7A, a receptor that directly activates SYK, rescued microglia activation in mice expressing the TREM2R47H allele, unveiling new options for AD immunotherapy.
2022-10-10 | GSE195518 | GEO
Project description:Intron 1-Mediated Regulation Of EGFR Expression In EGFR-Dependent Malignancies
| PRJNA526925 | ENA
Project description:As a first step towards identifying the target genes of EGFR activity in glioma cells, genome-wide expression analyses were performed using the Affymetrix GeneChip Human Genome U133A array. To accomplish this, mRNA expression levels of these genes were measured in the glioblastoma cell lines, U87 and U178, engineered with EGFR by retrovirus transduction (termed U87-EGFR and U178-EGFR respectively), with or without 20 ng/mL EGF treatment for 3 h. U87 and U178 cells engineered to express EGFR were stimulated with or without EGF. The experiment was replicated twice for each U87 and U178 cells.
2011-11-05 | E-GEOD-33442 | biostudies-arrayexpress
Project description:Cooperative dependencies between mutant oncoproteins and wild-type proteins are critical in cancer pathogenesis and therapy resistance. Although spleen tyrosine kinase (SYK) has been implicated in hematologic malignancies, it is rarely mutated. We used kinase activity profiling to identify collaborators of SYK in acute myeloid leukemia (AML) and determined that FMS-like tyrosine kinase 3 (FLT3) is transactivated by SYK via direct binding. Highly activated SYK is predominantly found in FLT3-ITD positive AML and cooperates with FLT3-ITD to activate MYC transcriptional programs. FLT3-ITD AML cells are more vulnerable to SYK suppression than FLT3 wild-type counterparts. In a FLT3-ITD in vivo model, SYK is indispensable for myeloproliferative disease (MPD) development, and SYK overexpression promotes overt transformation to AML and resistance to FLT3-ITD-targeted therapy. HL-60, MOLM-14, and U937 cell lines were transduced in triplicate with a control luciferase-directed shRNA (target sequence CCTAAGGTTAAGTCGCCCTCG), and in duplicate with two SYK-directed shRNAs: shSYK_1 (clone ID TRCN0000197257, target sequence GCAGCAGAACAGACATGTCAA) and shSYK_2 (clone ID TRCN0000003163 , target sequence GCAGGCCATCATCAGTCAGAA), and were then selected with 1 µg/ml puromycin 48 hours post-infection. At day 5 post-infection, RNA was extracted and profiled using HT HG-U133A arrays (Affymetrix) at the Broad Institute (Cambridge, MA, USA). The computational analysis of the gene expression data was performed through the Genome Space bioinformatics platform (http://www.genomespace.org).
2014-01-15 | E-GEOD-54065 | biostudies-arrayexpress
Project description:microRNA 27b-3p modulates SYK in Pediatric Asthma Induced by Dust Mites
| PRJNA491839 | ENA
Project description:The transcription factor Meis1 drives myeloid leukemogenesis in the context of Hox gene overexpression but is currently considered undruggable. We therefore investigated whether myeloid progenitor cells transformed by Hoxa9 and Meis1 become addicted to targetable signaling pathways. A comprehensive (phospho)proteomic analysis revealed that Meis1 increased Syk protein expression and activity. Syk upregulation occurs through a Meis1-dependent feed-forward loop. By dissecting this loop, we show that Syk is a direct target of miR-146a, whose expression is indirectly regulated by Meis1 through the transcription factor PU.1. In the context of Hoxa9 overexpression, Syk induces Meis1, recapitulating several leukemogenic features of Hoxa9/Meis1-driven leukemia. Finally, we show that Syk inhibition disrupts the identified regulatory loop, prolonging survival of mice with Hoxa9/Meis1-driven leukemia.
2017-06-14 | PXD004192 | Pride
Project description:Targeted therapy studies with small molecules against kinases, such as spleen tyrosine kinase (SYK), are underway in patients with acute myeloid leukemia (AML) and show promising initial results. Identifying the potential mechanism of resistance and finding new drug combinations to overcome them, however, is essential for the long-term success of these targeted agents. Here, we conducted a genome-scale ORF resistance screen and identified activation of the RAS/MAPK/ERK signaling pathway as one major mechanism of resistance to SYK inhibition. This finding was validated in AML cell lines with innate and acquired resistance to a SYK inhibitor and in AML samples from patients who developed resistance to SYK inhibition. In order to circumvent this resistance, we demonstrate the synergistic activity of a MEK Inhibitor in combination with a SYK inhibitor in RAS mutated cells, as well as in entospletinib-resistant AML cells.
2020-01-16 | GSE129698 | GEO
Project description:As a first step towards identifying the target genes of EGFR activity in glioma cells, genome-wide expression analyses were performed using the Affymetrix GeneChip Human Genome U133A array. To accomplish this, mRNA expression levels of these genes were measured in the glioblastoma cell lines, U87 and U178, engineered with EGFR by retrovirus transduction (termed U87-EGFR and U178-EGFR respectively), with or without 20 ng/mL EGF treatment for 3 h.
2011-11-05 | GSE33442 | GEO