The E. coli global regulator DksA attenuates transcription during T4 infection
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA438226 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Purpose: We investigated how deletion of DksA or ppGpp, two E. coli global transcription regulators, affects T4 infection. Method: B606, B606 DdksA, and B606 ppGpp0 were grown at 37C to early/mid log phase (OD600 ~ 0.4) then infected with moi of 10 of either wt T4 or T4motAam and total RNA was isolated. 2.5 µg total RNA from each sample was treated with a Ribo-Zero rRNA Removal Kit (Gram-Negative Bacteria; Illumina San Diego, CA) to deplete rRNA. The enriched mRNA was fragmented, reverse-transcribed, ligated with dual indexes, and amplified using a TruSeq Stranded mRNA Library Prep Kit (Illumina, San Diego, CA). The resulting RNA-Seq libraries were pooled at equal concentrations and sequenced using on an Illumina MiSeq to generate 2 x 100 bp paired-end reads. Read data in fastq format was demultiplexed and aligned to E. coli B str. DE3 (NC_012971.2) reference genome using STAR v2.5.2, retaining unmapped reads (Dobin, Davis et al. 2013). Unmapped reads were then mapped in a second step to T4 reference (NC_000866.4). In both cases, default alignment behavior was altered with the following arguments: --outFilterScoreMinOverLread 0 --outFilterMatchNmin 30 --outFilterMatchNminOverLread 0 --clip3pAdapterSeq AGATCGGAAGAGCGTCGTGTA --alignIntronMax 1. RNA gene counts in both reference genomes were then quantified using the same NCBI gene definitions utilized in mapping index construction using the subread featureCounts v1.4.6-p3 package (Liao, Smyth et al. 2014). Differential expression between samples fchanges in gene expression was predetermined to entail a fold change of more than or equal to 2 and P value less than or equal to 0.05. at 5 minutes post-infection. Result: Both ppGpp0 and delta(dksA) increase wt T4 plaque size. However, ppGpp0 does not significantly alter burst size/latent period and only modestly affects T4 transcript abundance, while delta(dskA) increases burst size (2-fold), does not affect latent period, and increases the abundance of several Pe RNAs at 5 min post-transcription. delta(dskA) also increases T4motAam plaque size with a much shorter latent period compared to T4motAam/wt infection, and the levels of specific middle RNAs increase due to more transcription from Pe's that extend into these middle genes. Conclusion: We conclude that DksA attenuates T4 early gene expression. Consequently, delta(dksA) results in a more productive wt infection and ameliorates the poor expression of middle genes in a T4motAam infection.
2018-03-15 | GSE111808 | GEO
Project description: Not available
| S-EPMC6024815 | biostudies-literature
Project description:Bacteriophage P1 along with λ and T4 phages are among the best described bacterial viruses in molecular biology. For years, P1 features as well as its life cycle have been studied and its complete genome was published. Undeciphered phenomenon of improved P1vir lytic development in the absence of DksA protein in cell engaged us to more holistic experimental approach. Bacterial wild type and dksA strains were cultured to OD600 = 0.2. Next, P1vir was added, samples were withdrawn at 0, 10 and 30 minutes after P1vir infection. Total RNA was isolated and checked for quality using the Bioanalyzer 2100. The sequencing run was conducted on the Illumina NovaSeq6000 platform. 30 million pair-end reads per samples were assessed with 101 pb read length. Reference P1 phage genome sequence and annotations were downloaded from GenBank. We have discovered many changes in virus transcriptome. For instance: downregulation of phage genes encoding the main repressor of lysogeny C1 or proteins triggering cell lysis (e.g., lysozyme, holin) and upregulation of genes encoding antiholins in dksA mutant. This results support our gentle lysis hypothesis – less efficient lysis, combined with minor improvements of phage development which may lead to higher phage yield in DksA-devoid cells. We have observed upregulated expression of phage genes responsible for virion-parts production in the dksA mutant. Interestingly, expression of lysogeny-related c8 gene is upregulated in the dksA mutant. We speculate that P1vir developing in the dksA host is at the brink of lysogeny but is unable to established it and eventually enters the lytic pathway. We also found some interesting events in host cells upon infection. P1vir is taking control of the cellular protein, sugar and lipid metabolism in both, the wild type and dksA mutant hosts. However, in dksA mutant several genes involved in sulfur metabolism were uniquely upregulated. It remains unclear if this associates with obtaining new energy sources or with global reprograming via H2S signaling functions. Generally, the hosts are reacting by activating SOS response or upregulating the heat shock proteins. But we also found downregulation of proteolysis which was unique for the dksA strain. We believe that this extensive and comprehensive study not only finds reasonable explanations for the improved P1vir development in dksA strain, but also makes a great contribution to the field of P1 phage biology. Funding: This research was funded by the National Science Center, Poland (grant PRELUDIUM 2013/09/N/NZ2/01899 to G.M.C.)
2021-04-30 | GSE173614 | GEO
Project description:Strains devoid of ppGpp (ΔrelA ΔspoT; called ppGpp0), and ppGpp0 dksA- exhibit several amino acid requirements for growth on minimal media. We found that overexpression of DksA can complement some of those requirements. Since DksA is a factor that binds to the RNA polymerase secondary channel, we wondered if other secondary channel proteins might also exert a similar role with respect to growth on minimal media. In our study we found that GreA and partially GreB can in fact complement these requirements under certain conditions. Here, we wished to investigate a broader effect of GreA and GreB on ppGpp0 and ppGpp0 dksA- strains. Since the parent strains are unable to grow in minimal media, we had to supplement the M9 glucose medium with a set of amino acids (DFHILQSTV). We found that both, GreA and GreB can affect a much larger set of genes in the absence of dksA, than in its presence. Also, GreA seems to affect more genes than GreB, under both conditions. We used microarrays to detail the effects of overproducing either GreA or GreB in cells devoid of ppGpp, in the dksA+ or dksA- background E. coli cells harbouring plasmids carrying either greA (pA = pHM1873) or greB (pB = pHM1874) genes, or vector control (pGB2), were monitored in an effort to elucidate the effects of their protein products. This was done in two backgrounds- either in E. coli ppGpp0 cells (ΔrelA, ΔspoT) carrying wt dksA gene or a dksA deletion.
2011-10-26 | E-GEOD-28795 | biostudies-arrayexpress
Project description:Strains devoid of ppGpp (ΔrelA ΔspoT; called ppGpp0), and ppGpp0 dksA- exhibit several amino acid requirements for growth on minimal media. We found that overexpression of DksA can complement some of those requirements. Since DksA is a factor that binds to the RNA polymerase secondary channel, we wondered if other secondary channel proteins might also exert a similar role with respect to growth on minimal media. In our study we found that GreA and partially GreB can in fact complement these requirements under certain conditions. Here, we wished to investigate a broader effect of GreA and GreB on ppGpp0 and ppGpp0 dksA- strains. Since the parent strains are unable to grow in minimal media, we had to supplement the M9 glucose medium with a set of amino acids (DFHILQSTV). We found that both, GreA and GreB can affect a much larger set of genes in the absence of dksA, than in its presence. Also, GreA seems to affect more genes than GreB, under both conditions. We used microarrays to detail the effects of overproducing either GreA or GreB in cells devoid of ppGpp, in the dksA+ or dksA- background
2011-10-27 | GSE28795 | GEO
Project description:Transcriptional profiles of wt and dksA minus Salmonella enterica sv Typhimurium 14028S in E salts minimal medium in response to 5 mM DETANONOate for 30 min Total RNA was harvested from three biological replicates of wt and dksA mutant cultures exposed or unexposed to 5mM DETANONOate for 30min in E salts minimal medium.
2014-03-31 | E-GEOD-33529 | biostudies-arrayexpress
Project description:DksA is well-known for its regulatory role in the transcription of ribosomal RNA and genes involved in amino acid synthesis in many bacteria. DksA is also reported to control expression of virulence genes in pathogenic bacteria. Here, we elucidated the roles of the DksA-like protein (CJJ81176_0160, Cj0125c) in the pathogenesis of Campylobacter jejuni. Like in other bacteria, transcription of stable RNA was repressed by DksA under stressful conditions in C. jejuni. Transcriptomic and proteomic analyses of C. jejuni 81-176 and its isogenic dksA mutant showed differential expression of many genes involved in iron-related metabolism, flagellar synthesis and amino acid metabolism. Also the dksA mutant of C. jejuni demonstrated a decreased ability to invade into intestinal cells and to induce release of interleukin-8 from intestinal cells. These results suggest the DksA-like protein plays an important regulatory role in the physiology and virulence of C. jejuni. Keywords: dksA mutation of Campylobacter jejuni The design utilized a commercially available two color microarray slide for the enture transcriptome of Campylobacter jejuni. Six hybridizations were performed each with independently extracted samples of either C. jejuni wildtype of C. jejuni dksA mutant cDNA samples. A dye swap was utilized to help minimize dye dependent bias. Thus there were six biological replicates of each sample.
2008-05-05 | E-GEOD-9866 | biostudies-arrayexpress
Project description:DksA is well-known for its regulatory role in the transcription of ribosomal RNA and genes involved in amino acid synthesis in many bacteria. DksA is also reported to control expression of virulence genes in pathogenic bacteria. Here, we elucidated the roles of the DksA-like protein (CJJ81176_0160, Cj0125c) in the pathogenesis of Campylobacter jejuni. Like in other bacteria, transcription of stable RNA was repressed by DksA under stressful conditions in C. jejuni. Transcriptomic and proteomic analyses of C. jejuni 81-176 and its isogenic dksA mutant showed differential expression of many genes involved in iron-related metabolism, flagellar synthesis and amino acid metabolism. Also the dksA mutant of C. jejuni demonstrated a decreased ability to invade into intestinal cells and to induce release of interleukin-8 from intestinal cells. These results suggest the DksA-like protein plays an important regulatory role in the physiology and virulence of C. jejuni. Keywords: dksA mutation of Campylobacter jejuni
2008-05-06 | GSE9866 | GEO
Project description:In bacteria, translation-transcription coupling inhibits RNA polymerase (RNAP) stalling. We present evidence suggesting that, upon amino acid starvation, inactive ribosomes promote rather than inhibit RNAP stalling. We developed an algorithm to evaluate genome-wide polymerase progression independently of local noise, and used it to reveal that the transcription factor DksA inhibits promoter-proximal pausing and increases RNAP elongation when uncoupled from translation by depletion of charged tRNAs. DksA has minimal effect on RNAP elongation in vitro and on untranslated RNAs in vivo. In these cases, transcripts can form RNA structures that prevent backtracking. Thus, the effect of DksA on transcript elongation may occur primarily upon ribosome slowing/stalling or at promoter-proximal locations that limit the potential for RNA structure. We propose that inactive ribosomes prevent formation of backtrackblocking mRNA structures and that, in this circumstance, DksA acts as a transcription elongation factor in vivo. Chromatin immunoprecipitation (ChIP) experiments were performed by using antibodies against RNA polymerase b subunit in wild-type and DdksA cells treated with 0.5mg/ml serine hydroxamate (SHX) or untreated. DksA and s70 enrichments were compared to RNAP enrichment by ChIP experiments using antibodies against s70 and DksA in wild-type cells (also in DdksA cells as a negative control for DksA ChIP-chip). Differentially labeled ChIP DNA and genomic DNA were competitively hybridized to an E. coli K-12 MG1655 tiling array with overlapping probes at ~12bp spacing across the entire genome. The series contains 19 datasets.
2014-04-21 | E-GEOD-54669 | biostudies-arrayexpress
Project description:The pathogenic spirochete Borrelia burgdorferi senses and responds to diverse environmental challenges, including changes in nutrient availability, throughout its natural infectious cycle in Ixodes spp. ticks and mammalian hosts. This study examined the role of the putative DnaK suppressor protein (DksA) in the transcriptional response of B. burgdorferi to starvation. Wild-type and dksA-deficient B. burgdorferi strains were subjected to starvation by shifting mid-logarithmic cultures grown in BSK-II medium to serum-free RPMI medium for six hours under microaerobic conditions (5% CO2, 3% O2). Microarray analyses of wild-type B. burgdorferi revealed that genes encoding flagellar components, ribosomal proteins, and DNA replication machinery were downregulated in response to starvation. DksA mediated transcriptomic responses to starvation in B. burgdorferi as the dksA-deficient B. burgdorferi strain differentially expressed only 47 genes in response to starvation compared to the 500 genes differentially expressed by wild-type strains. Consistent with a role for DksA in the starvation response of B. burgdorferi, fewer CFUs were observed for dksA-deficient spirochetes after prolonged starvation in RPMI medium compared to wild-type B. burgdorferi. Transcriptomic analyses revealed a partial overlap between the DksA regulon and the regulon of the guanosine tetraphosphate and guanosine pentaphosphate [(p)ppGpp] synthase RelBbu, while the DksA regulon also included many plasmid-borne genes. Corresponding to a DksA-(p)ppGpp regulatory relationship, (p)ppGpp levels were constitutively elevated in the dksA-deficient strain compared to the wild-type strain. Together, these data indicate that DksA directs the stringent response with a regulatory interplay with (p)ppGpp that is fundamental to B. burgdorferi responses to the environment.
2018-12-18 | GSE119023 | GEO