Next-generation sequencing of control (scramble) and Myo1c knockdown human podocytes, with and without TGF-β treatment
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA486852 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Purpose: Next-generation sequencing (NGS) was used to identify cellular pathways and genes through systems-based analysis. The goals of this study are to identify NGS-derived transcriptome profiling (RNA-seq) in control and Myo1c knockdown human podocytes upon TGFβ stimulation. These high-throughput data were further validated through qRT–PCR methods to confirm the cellular pathways and genes affected due to genetic knockdown of Myo1c and TGF-β stimulation. Methods: Human control and Myo1c knockdown podocytes were differentiated for 14 days by thermoswitching from 33⁰C to 37⁰C and removal of growth factors, insulin-transferrin-selenium from the medium. These podocytes were incubated overnight in RPMI medium with 0.1% FBS and stimulated with 5ng/ml of TGF-β in the same medium for a period of 48 hours. Control and TGF-β stimulated podocytes were processed for RNA isolation and submitted to Novogene for RNA-Seq. All the experiments were performed in triplicates. Conclusions: Our study is first to describe the detailed analysis of TGF-β stimulated Myo1c knockdown podocyte transcriptomes using the RNA-seq technology. A comparative analysis of the differential expression profile was obtained between control vs. Myo1c knockdown podocytes, and control vs. Myo1c knockdown podocytes that were stimulated with TGF-β. Complex genetic network and genes effected due to Myo1c knockdown and TGF-β stimulation will provide a platform to define biological pathways in podocytes where Myo1c participates.
2018-08-21 | GSE118816 | GEO
Project description:To identify miRNAs regulating CTGF at the downstream of TGF-β, we analyzed expression profiles of human miRNAs in immortalized human podocytes.
2015-05-31 | GSE66133 | GEO
Project description:We report trancriptional changes between wildtype mouse immortalized podocytes and compared to podocytes with shRNA-knockdown of Pdss2.
2021-02-01 | GSE164272 | GEO
Project description:MS analysis of proteins interacting with PKA and TGF-β1 in HEK293T cells. MS analysis of immunoprecipitated TGF-β1 in HEK293T cells with TGF-β1 overexpression.
2022-06-28 | PXD031801 | Pride
Project description:Purpose: Next-generation sequencing (NGS) was used to define the transcriptome of native mouse podocytes and non-podocytes glomerular cells as part of a project aiming to define the molecular fingerprint of mouse podocytes. Method: Glomeruli from 29 Gt(ROSA)26Sortm4(ACTB-tdTomato,-EGFP)Luo/J x hNPHS2Cre mice at the age of 10 weeks were purified and a single cell solution was prepared to seperate GFP-expressing (podocytes) and GFP-negative (non-podocytes glomerular cells) cells by FACS sorting. RNA was extracted and prepared for further analysis using directional, polyA+ library preparation. An Illumina HiSeq2500 was used for a paired-end sequencing of 100 cycles . Salmon and Sleuth were used for downstream analysis. Results: A total of 100 Million reads each from podocytes and non-podocytes glomerular cells could be used for further analysis.
2019-01-01 | E-MTAB-5457 | biostudies-arrayexpress
Project description:Purpose: Next-generation sequencing (NGS) was used to identify cellular pathways and genes through systems-based analysis. The goals of this study are to identify NGS-derived transcriptome profiling (RNA-seq) in control (untreated) and Injured (PAN and Adriamycin) podocyte. These high throughput data were further validated through qRT–PCR methods to confirm the cellular pathways and genes affected due to the podocyte injury. Methods: Human podocytes were differentiated for 14 days by thermoswitching from 33⁰C to 37⁰C and removal of growth factors, insulin-transferrin-selenium from the medium. These podocytes were incubated 4hour in serum free RPMI medium and injury was induced by using PAN (100μg/ml) and Adriamycin (0.25μg/ml) treatment for 48 hours.Further, podocytes were processed for RNA isolation and submitted to Medical University of South Carolina Sequencing Core facility for RNA-Seq. All the experiments were performed in triplicates. Conclusions: Our study is first to describe the detailed analysis of PAN and Adriamycin induced podocyte transcriptomes using the RNA-seq technology. A comparative analysis of the differential expression profile was obtained between control vs PAN injured podocytes, and control vs Adriamycin injured podocytes. Complex genetic network and genes effected due to the injury will provide a platform to define biological pathways participate during podocytes injury process.
2019-03-31 | GSE124622 | GEO
Project description:We subjected human podocytes with and without alpha-Galactosidase knockdown to proteomic analysis.
2018-10-17 | PXD007080 | Pride
Project description:This is a set of proteomics performed on murine podocytes derived from a GSK3alpha/beta floxed mouse. GSK3 has been knocked down in the podocytes using lentiviral cre. This was performed 3 days prior to the analysis. For more details see paper entitled "Podocyte GSK3 is an evolutionarily conserved critical regulator of kidney function" published in Nature Communications.
2019-11-14 | PXD012145 | Pride
Project description:CCAT1-L is a highly expressed long noncoding RNA located in the colorectal cancer specific super enhance region about 500 kb upstream of MYC gene. Knockdown of CCAT1-L significantly down-regulated interaction frequency between CCAT1 and MYC locus and repress MYC expression, suggesting a long-range chromatin interaction between CCAT1-L and MYC locus maintained by CCAT1-L underlie the MYC regulation. To further validate this hypothesis, multiplexed 3C sequencing (3C-seq) was employed to evaluate chromatin interaction strength between CCAT1-L and MYC locus in CCAT1-L knockdown and scramble knockdown (Scr) HT29 cells. The 3C-Seq design and data analysis were performed according to Stadhouders et al, Nat Protoc. 2013, 8:509-524. A series of bait sequences accommodating different locus around CCAT1-L and MYC were selected. Through integrating with specific sample barcodes, bait-specific primer sets were designed to construct relevant 3C-seq libraries in CCAT1-L knockdown and scramble knockdown (Scr) HT29 samples. All of the 3C sample libraries from different treatment, including CCAT1-L knockdown and scramble knockdown (Scr), were then pooled together for high-throughput sequencing. Two technical 3C-seq were performed (CCAT1_myc_3C_1.txt.gz and CCAT1_myc_3C_2.txt.gz) and then combined together to get enough reads for further analysis. 3C-seq reads from different samples were divided according to sample barcodes (CCAT1-L knockdown: ATGTCA; Scr: GCCAAT) and different bait sequences, and then mapped to human reference genome to assess chromatin interaction strength between CCAT1-L and MYC locus in different treatments. In our study, one representative bait-specific sequencing data (CTTCTACTGATTGGCCCTAAACACTTTTCCAAAGCTT) was select to generate bedgraph files and upload to UCSC for visualization to show the chromatin interaction between CCAT1-L and Myc locus in CCAT1-L knockdown (CCAT1-L_knockdown_out.bedgraph) and scramble knockdown (Scr_out.bedgraph) samples.
2014-02-22 | E-GEOD-55261 | biostudies-arrayexpress
Project description:Podocytes play an important filtration role in the kidney. We examined culture condition for efficient podocyte induction and established a method to selectively induce podocytes from human iPS cells. To understand how expression profiles of human iPS cell-derived podocytes were close to that in vivo, we isolated human adult podocytes for human adult kidney. Purified RNAs from human iPS cells, nephron progenitor cells, human immortalized podocyte cell line, human iPS cell-derived podocytes, and sorted human adult podocytes were analyzed by RNA-seq.
2019-01-15 | GSE116471 | GEO