Groundwater metagenome
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA514085 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Pristine groundwater is a highly stable environment with microbes adapted to dark, oligotrophic conditions. Input events like heavy rainfalls can introduce excess particulate organic matter including surface-derived microbes into the groundwater, hereby creating a disturbance to the groundwater microbiome. Some of the translocated bacteria are not able to thrive in groundwater and will form necromass. Here, we investigated the effects of necromass addition to the microbial community in fractured bedrock groundwater, using groundwater mesocosms as model systems. We followed the uptake of 13C-labeled necromass by the bacterial and eukaryotic groundwater community quantitatively and over time by employing a combined protein and DNA stable isotope probing approach. Necromass was rapidly depleted in the mesocosms within four days, accompanied by a strong decrease of Shannon diversity and an increase of bacterial 16S rRNA gene copy numbers by one order of magnitude. Species of Flavobacterium, Massilia, Rheinheimera, Rhodoferax and Undibacterium dominated the microbial community within two days and were identified as key players in necromass degradation, based on a 13C incorporation of > 90% in their peptides. Their proteomes showed various uptake and transport related proteins, and many proteins involved in metabolizing amino acids. After four and eight days of incubation, autotrophic and mixotrophic groundwater species of Nitrosomonas, Limnohabitans, Paucibacter and Acidovorax increased in abundance, with a 13C incorporation between 0.5 and 23%. Our data point towards a very fast and exclusive uptake of labeled necromass by a few specialists followed by a concerted action of groundwater microorganisms, including autotrophs presumably fueled by released, reduced nitrogen and sulfur compounds generated during necromass degradation.
2022-05-31 | PXD031173 | Pride
Project description:Sensitive models of climate change impacts would require a better integration of multi-omics approaches that connect the abundance and activity of microbial populations. Here, we show that climate is a fundamental driver of the protein abundance of microbial populations (metaproteomics), yet not their genomic abundance (16S rRNA gene amplicon sequencing), supporting the hypothesis that metabolic activity may be more closely linked to climate than community composition.
2022-03-01 | PXD009773 | Pride
Project description:16S rRNA gene amplicon sequencing of groundwater batches sparged with hydrogen
| PRJNA626487 | ENA
Project description:16S rRNA gene and metagenomic sequencing analysis of deep granitic groundwater
| PRJDB11666 | ENA
Project description:Gut microbiota were assessed in 540 colonoscopy-screened adults by 16S rRNA gene sequencing of stool samples. Investigators compared gut microbiota diversity, overall composition, and normalized taxon abundance among these groups.
| 2255499 | ecrin-mdr-crc
Project description:In this study we developed metaproteomics based methods for quantifying taxonomic composition of microbiomes (microbial communities). We also compared metaproteomics based quantification to other quantification methods, namely metagenomics and 16S rRNA gene amplicon sequencing. The metagenomic and 16S rRNA data can be found in the European Nucleotide Archive (Study number: PRJEB19901). For the method development and comparison of the methods we analyzed three types of mock communities with all three methods. The communities contain between 28 to 32 species and strains of bacteria, archaea, eukaryotes and bacteriophage. For each community type 4 biological replicate communities were generated. All four replicates were analyzed by 16S rRNA sequencing and metaproteomics. Three replicates of each community type were analyzed with metagenomics. The "C" type communities have same cell/phage particle number for all community members (C1 to C4). The "P" type communities have the same protein content for all community members (P1 to P4). The "U" (UNEVEN) type communities cover a large range of protein amounts and cell numbers (U1 to U4). We also generated proteomic data for four pure cultures to test the specificity of the protein inference method. This data is also included in this submission.
2017-05-12 | PXD006118 | Pride
Project description:The impact of mono-chronic S. stercoralis infection on the gut microbiome and microbial activities in infected participants was explored. The 16S rRNA gene sequencing of a longitudinal study with 2 sets of human fecal was investigated. Set A, 42 samples were matched, and divided equally into positive (Pos) and negative (Neg) for S. stercoralis diagnoses. Set B, 20 samples of the same participant in before (Ss+PreT) and after (Ss+PostT) treatment was subjected for 16S rRNA sequences and LC-MS/MS to explore the effect of anti-helminthic treatment on microbiome proteomes.
2023-11-07 | PXD037975 | JPOST Repository
Project description:Amplicon sequencing of 16S rRNA gene
| PRJDB7080 | ENA
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO