Ontology highlight
ABSTRACT:
PROVIDER: PRJNA515368 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Acquired resistance of temozolomide (TMZ) is one of the major obstacle of glioblastoma clinical treatment and the mechanism of TMZ resistance is still not very clear. In the presented research we show that deletion of rs16906252-associated MGMT enhancer in MGMT negative glioma cells induced increase sensitivity to temozolomide and combination of RNA-seq and Capture HiC identified several long-range target genes of rs16906252-associated MGMT enhancer. In addition, HiC data shows alterations of chromatin structures in glioma cells survived from high-dosage TMZ treatment and changes of TADs influence rs16906252-associated MGMT enhancer’s long-range regulations of target genes. Our study suggests rs16906252-associated MGMT enhancer regulates glioma cells’ TMZ sensitivity by long-range regulations of several target genes, which is a novel mechanism of regulation of TMZ sensitivity in glioma cells.
2020-04-02 | GSE129476 | GEO
Project description:Temozolomide (TMZ) resistance of glioma cells is currently a critical problem in glioma clinical treatment. In this study, we reveal a bivalent function of a super-enhancer RNA LINC02454 in modulating glioma cell sensitivity to TMZ via regulation of SORBS2 and DDR expression. LINC02454 increased TMZ sensitivity by maintaining 3D chromatin structure and promoting SORBS2 expression, but paradoxically decreased TMZ sensitivity by binding to the DDR1 locus and promoting DDR1 transcription. This study proposes a new regulatory mechanism governing glioma cell sensitivity to TMZ and provides new insights that may improve therapies against glioma.
2024-01-10 | GSE229600 | GEO
Project description:Gene expression is controlled under spatial chromatin structures with short-range in topologically associating domains (TAD) and long-range chromatin interactions between TADs, compartments or chromosomes, and disruption of chromatin structure leads to human diseases. The mechanism of short-range chromatin interactions has been well characterized by loop-extrusion model, but little is known about how long-range chromatin interactions are organized. Here, we demonstrate that CTCF contributes to long-range chromatin interactions via phase separation. Surprisingly, RYBP is required for the phase separation and long-range chromatin organization of CTCF. Artificial CTCF phase seperation restores the long-range chromatin interactions and corresponding gene expression which were eliminated by RYBP depletion, and manipulation of CTCF phase separation also maintains pluripotency and inhibits differentation of embryonic stem cells. These findings support a model that long-range chromatin interactions are organized through phase sepearation of architectural protein, and further reveals the distinct mechanisms of architectural protein in organizing short-range and long-range chromatin interactions.
2022-08-10 | GSE147919 | GEO
Project description:We developed a targeted chromosome conformation capture (4C) approach that uses unique molecular identifiers (UMI) to derive high complexity quantitative chromosome contact profiles with controlled signal to noise ratios. We demonstrate that the method improves the sensitivity and specificity for detection of long-range chromosomal interactions, and that it allows the design of interaction screens with predictable statistical power. UMI-4C robustly quantifies contact intensity changes between cell types and conditions, opening the way toward incorporation of long-range interactions in quantitative models of gene regulation.
2016-06-15 | GSE76763 | GEO
Project description:We developed a targeted chromosome conformation capture (4C) approach that uses unique molecular identifiers (UMI) to derive high complexity quantitative chromosome contact profiles with controlled signal to noise ratios. We demonstrate that the method improves the sensitivity and specificity for detection of long-range chromosomal interactions, and that it allows the design of interaction screens with predictable statistical power. UMI-4C robustly quantifies contact intensity changes between cell types and conditions, opening the way toward incorporation of long-range interactions in quantitative models of gene regulation.
2016-09-23 | GSE87209 | GEO
Project description:Immunoglobulin class switch recombination (CSR) is initiated by the transcription-coupled recruitment of activation induced cytidine deaminase (AID) to immunoglobulin switch (S) regions. During CSR, the IgH locus undergoes dynamic three-dimensional structural changes in which promoters, enhancers and S regions are brought to close proximity. Nevertheless, little is known about the underlying mechanisms. Here we conditionally inactivated in B cells the Med1 subunit of mediator, a complex implicated in transcription initiation and long-range enhancer/promoter loop formation. We find that Med1-deficiency results in defective CSR, reduced acceptor switch region transcription and that this correlates with reduced long-range interactions between the acceptor switch regions and the Em enhancer, as determined by 4C-Seq. Our results implicate the mediator complex in the mechanism of CSR and are consistent with a model in which Med1 facilitates the transcriptional activation of switch regions and their long-range contacts with the IgH locus enhancers during CSR. 4C-seq data in resting and activated WT and Med1 mutant B cells. 4C bait was designed in the Eu enhancer of the Igh locus on chromosome 12. Primer sequences: 5â TCTGTCCTAAAGGCTCTGAGA 3â and 5â GAACACAGAAGTATGTGTATGGA 3â.
2016-02-17 | E-GEOD-62969 | biostudies-arrayexpress
Project description:Gene transcription can be regulated by remote enhancer regions through chromosome looping either in cis or in trans. Cancer cells are characterized by wholesale changes in long-range gene interactions, but the role that these long-range interactions play in cancer progression and metastasis is not well understood. In this study, we used IGFBP3, a gene involved in breast cancer pathogenesis, as bait in a 4C-seq experiment comparing normal breast cells (HMEC) with two breast cancer cell lines (MCF7, an ER positive cell line, and MDA-MB-231, a triple negative cell line). The IGFBP3 long-range interaction profile was substantially altered in breast cancer. Many interactions seen in normal breast cells are lost and novel interactions appear in cancer lines. We found that in HMEC, the breast carcinoma amplified sequence gene family (BCAS) 1-4 were among the top 10 most significantly enriched regions of interaction with IGFBP3. 3D-FISH analysis indicated that the translocation-prone BCAS genes, which are located on chromosomes 1, 17 and 20, are in close physical proximity with IGFBP3 and each other in normal breast cells. We also found that epidermal growth factor receptor (EGFR), a gene implicated in tumorigenesis, interacts significantly with IGFBP3 and that this interaction may play a role in their regulation. Breakpoint analysis suggests that the interchromosomal rearrangements seen in the MCF7 cancer cell line involve regions that engage in long-range interactions in normal breast cells. Overall, our data from multiple lines of evidence suggest an important role for long-range chromosomal interactions in the pathogenesis of cancer. Comparison of IGFBP3 interaction profiles in normal breast tissue and 2 breast tumor subtypes
2013-08-03 | E-GEOD-49521 | biostudies-arrayexpress
Project description:We developed a targeted chromosome conformation capture (4C) approach that uses unique molecular identifiers (UMI) to derive high complexity quantitative chromosome contact profiles with controlled signal to noise ratios. We demonstrate that the method improves the sensitivity and specificity for detection of long-range chromosomal interactions, and that it allows the design of interaction screens with predictable statistical power. UMI-4C robustly quantifies contact intensity changes between cell types and conditions, opening the way toward incorporation of long-range interactions in quantitative models of gene regulation. We constructed UMI-4C profiles of 13 different genomic loci (viewpoints) in five different cell lines, in order to study the 3D chromatin contact maps of these selected loci. The coordinates for these viewpoints are: G1p1 chrX:48646542; baitG1_3_5kb chrX:48641393; bait_50kb chrX:48595987; bait_165kb chrX:48476525; ANK1 chr8:41654693; hbb_3HS chr11:5221346; hbb_HBB chr11:5248714; hbb_HBBP1_G1 chr11:5266532; HBB_HBE chr11:5292159; HBB_HS2 chr11:5301345; HBB_HS3 chr11:5306690; HBB_HS5 chr11:5313539; HBB_HBD chr11:5256597
2016-06-15 | E-GEOD-76763 | biostudies-arrayexpress