Project description:Genome-wide comparative analyses of the open chromatin profiles between equivalent stages of mouse and pig limb bud development reveal the extensive functional divergence of their limb regulomes. These alterations affect evolutionary conserved regions located in the genomic landscapes of genes with essential functions during limb development. This analysis uncovers the widespread regulatory changes that appear to underlie the morphological diversion of the artiodactyl limb from the pentadactyl blueprint of tetrapods.
Project description:Genome-wide comparative analyses of the open chromatin profiles between equivalent stages of mouse and pig limb bud development reveal the extensive functional divergence of their limb regulomes. These alterations affect evolutionary conserved regions located in the genomic landscapes of genes with essential functions during limb development. This analysis uncovers the widespread regulatory changes that appear to underlie the morphological diversion of the artiodactyl limb from the pentadactyl blueprint of tetrapods.
Project description:The evolution of human anatomical features likely involved changes in gene regulation during development. However, the nature and extent of human specific developmental regulatory functions remain unknown. We obtained a genome-wide view of cis regulatory evolution in human embryonic tissues by comparing the histone modification H3K27ac, which provides a quantitative readout of promoter and enhancer activity, during human, rhesus, and mouse limb development. Based on increased H3K27ac, we find that 13% of promoters and 11% of enhancers have gained activity on the human lineage since the human-rhesus divergence. These gains largely arose by modification of ancestral regulatory activities in the limb or potential co-option from other tissues and are likely to have heterogeneous genetic causes. Most enhancers that exhibit gain of activity in humans originated in mammals. Gains at promoters and enhancers in the human limb are associated with increased gene expression, suggesting they include molecular drivers of human morphological evolution. ChIP-Seq and RNA-Seq of autopod tissue of developing limb buds of Human (E33-E47), rhesus (E31-E36), and mouse (E10.5-E13.5). No raw data are provided for human samples. Human alignments were anonymized by removing sequence information and converting to bed format.
Project description:The evolution of human anatomical features likely involved changes in gene regulation during development. However, the nature and extent of human specific developmental regulatory functions remain unknown. We obtained a genome-wide view of cis regulatory evolution in human embryonic tissues by comparing the histone modification H3K27ac, which provides a quantitative readout of promoter and enhancer activity, during human, rhesus, and mouse limb development. Based on increased H3K27ac, we find that 13% of promoters and 11% of enhancers have gained activity on the human lineage since the human-rhesus divergence. These gains largely arose by modification of ancestral regulatory activities in the limb or potential co-option from other tissues and are likely to have heterogeneous genetic causes. Most enhancers that exhibit gain of activity in humans originated in mammals. Gains at promoters and enhancers in the human limb are associated with increased gene expression, suggesting they include molecular drivers of human morphological evolution.
Project description:The evolution of tetrapod limbs from fish fins enabled the conquest of land by vertebrates and thus represents a key step in evolution. Despite the use of comparative gene expression analyses, critical aspects of this transformation remain controversial, in particularly the origin of digits. Hoxa and Hoxd genes are essential for the specification of the different limb segments and their functional abrogation leads to large truncations of the appendages. Here we show that the selective transcription of mouse Hoxa genes in proximal and distal limbs is related to a bimodal higher order chromatin structure, similar to that reported for Hoxd genes, thus revealing a generic regulatory strategy implemented by both gene clusters during limb development. We found the same bimodal chromatin architecture in fish embryos, indicating that the regulatory strategy used to pattern tetrapod limbs predates the divergence between fish and tetrapods. However, when assessed in mice, both fish regulatory domains triggered transcription in proximal, rather than distal limb territories, supporting an evolutionary scenario whereby digits arose as true tetrapod novelties through genetic retrofitting of a preexisting bimodal chromatin framework. We discuss the possibility to consider regulatory circuitries, rather than expression patterns, as essential parameters to define evolutionary synapomorphies. Circular Chromosome Conformation Capture (4C seq) at the mouse HoxA and HoxD loci in proximal and distal forelimbs and forebrain at E12.5 and at the zebrafish HoxAa, HoxAb and HoxDa loci in 5 dpf whole embryos.
Project description:Gene regulatory divergence is thought to play a central role in determining human-specific traits. However, our ability to link divergent regulation to divergent phenotypes is limited. Here, we utilized human-chimpanzee hybrid induced pluripotent stem cells to study divergent gene expression separating these species. The hybrid cells allowed us to separate cis- from trans-regulatory effects, and to control for non-genetic factors that often confound comparative studies. We differentiated these cells into cranial neural crest cells (CNCCs), the primary cell type giving rise to the face, and used the hybrid cells to generate a catalogue of divergent cis-regulatory gene expression between humans and chimpanzees. We found that cis-regulatory divergence is tightly linked to phenotypic divergence, enabling the identification of candidate genes associated with several divergent traits. Specifically, we find support for lineage-specific selection acting on the cis-regulation of the hedgehog signaling pathway. This pathway includes EVC2 (LIMBIN), whose cis-regulation is among the most divergent in the genome, resulting in 6-fold down-regulation along the human lineage. We found that inducing a similar reduction in EVC2 levels substantially reduces Hh signaling output. Mice and humans lacking functional EVC2 show striking parallels to many human-chimpanzee phenotypic differences, particularly in the skull and face, suggesting that the regulatory divergence of Hh signaling may have contributed to the unique craniofacial morphology of humans. In sum, our results suggest that human-chimpanzee hybrid cells can serve as a valuable resource to study the evolution of gene regulation and its impact on phenotypic divergence. SRA/fastq files include Illumina adapters (GATCGGAAGAGCACACGTCT and GATCGGAAGAGCGTCGTGTA).
Project description:The evolution of tetrapod limbs from fish fins enabled the conquest of land by vertebrates and thus represents a key step in evolution. Despite the use of comparative gene expression analyses, critical aspects of this transformation remain controversial, in particularly the origin of digits. Hoxa and Hoxd genes are essential for the specification of the different limb segments and their functional abrogation leads to large truncations of the appendages. Here we show that the selective transcription of mouse Hoxa genes in proximal and distal limbs is related to a bimodal higher order chromatin structure, similar to that reported for Hoxd genes, thus revealing a generic regulatory strategy implemented by both gene clusters during limb development. We found the same bimodal chromatin architecture in fish embryos, indicating that the regulatory strategy used to pattern tetrapod limbs predates the divergence between fish and tetrapods. However, when assessed in mice, both fish regulatory domains triggered transcription in proximal, rather than distal limb territories, supporting an evolutionary scenario whereby digits arose as true tetrapod novelties through genetic retrofitting of a preexisting bimodal chromatin framework. We discuss the possibility to consider regulatory circuitries, rather than expression patterns, as essential parameters to define evolutionary synapomorphies.