Project description:Targeted therapy studies with small molecules against kinases, such as spleen tyrosine kinase (SYK), are underway in patients with acute myeloid leukemia (AML) and show promising initial results. Identifying the potential mechanism of resistance and finding new drug combinations to overcome them, however, is essential for the long-term success of these targeted agents. Here, we conducted a genome-scale ORF resistance screen and identified activation of the RAS/MAPK/ERK signaling pathway as one major mechanism of resistance to SYK inhibition. This finding was validated in AML cell lines with innate and acquired resistance to a SYK inhibitor and in AML samples from patients who developed resistance to SYK inhibition. In order to circumvent this resistance, we demonstrate the synergistic activity of a MEK Inhibitor in combination with a SYK inhibitor in RAS mutated cells, as well as in entospletinib-resistant AML cells.
Project description:Cooperative dependencies between mutant oncoproteins and wild-type proteins are critical in cancer pathogenesis and therapy resistance. Although spleen tyrosine kinase (SYK) has been implicated in hematologic malignancies, it is rarely mutated. We used kinase activity profiling to identify collaborators of SYK in acute myeloid leukemia (AML) and determined that FMS-like tyrosine kinase 3 (FLT3) is transactivated by SYK via direct binding. Highly activated SYK is predominantly found in FLT3-ITD positive AML and cooperates with FLT3-ITD to activate MYC transcriptional programs. FLT3-ITD AML cells are more vulnerable to SYK suppression than FLT3 wild-type counterparts. In a FLT3-ITD in vivo model, SYK is indispensable for myeloproliferative disease (MPD) development, and SYK overexpression promotes overt transformation to AML and resistance to FLT3-ITD-targeted therapy.
Project description:Cooperative dependencies between mutant oncoproteins and wild-type proteins are critical in cancer pathogenesis and therapy resistance. Although spleen tyrosine kinase (SYK) has been implicated in hematologic malignancies, it is rarely mutated. We used kinase activity profiling to identify collaborators of SYK in acute myeloid leukemia (AML) and determined that FMS-like tyrosine kinase 3 (FLT3) is transactivated by SYK via direct binding. Highly activated SYK is predominantly found in FLT3-ITD positive AML and cooperates with FLT3-ITD to activate MYC transcriptional programs. FLT3-ITD AML cells are more vulnerable to SYK suppression than FLT3 wild-type counterparts. In a FLT3-ITD in vivo model, SYK is indispensable for myeloproliferative disease (MPD) development, and SYK overexpression promotes overt transformation to AML and resistance to FLT3-ITD-targeted therapy. HL-60, MOLM-14, and U937 cell lines were transduced in triplicate with a control luciferase-directed shRNA (target sequence CCTAAGGTTAAGTCGCCCTCG), and in duplicate with two SYK-directed shRNAs: shSYK_1 (clone ID TRCN0000197257, target sequence GCAGCAGAACAGACATGTCAA) and shSYK_2 (clone ID TRCN0000003163 , target sequence GCAGGCCATCATCAGTCAGAA), and were then selected with 1 µg/ml puromycin 48 hours post-infection. At day 5 post-infection, RNA was extracted and profiled using HT HG-U133A arrays (Affymetrix) at the Broad Institute (Cambridge, MA, USA). The computational analysis of the gene expression data was performed through the Genome Space bioinformatics platform (http://www.genomespace.org).
Project description:Following the discovery of BRD4 as a non-oncogene addiction target in acute myeloid leukemia (AML), BET inhibitors are being explored as promising therapeutic avenue in numerous cancers. While clinical trials have reported single-agent activity in advanced hematologic malignancies, mechanisms determining the response to BET inhibition remain poorly understood. To identify factors involved in primary and acquired BET resistance in leukemia, we performed a chromatin-focused shRNAmir screen in a sensitive MLL/AF9; NrasG12D‑driven AML model, and investigated dynamic transcriptional profiles in sensitive and resistant murine and human leukemias. Our screen reveals that suppression of the PRC2 complex, contrary to effects in other contexts, promotes BET resistance in AML. PRC2 suppression does not directly affect the regulation of Brd4-dependent transcripts, but facilitates the remodeling of regulatory pathways that restore the transcription of key targets such as Myc. Similarly, while BET inhibition triggers acute MYC repression in human leukemias regardless of their sensitivity, resistant leukemias are uniformly characterized by their ability to rapidly restore MYC transcription. This process involves the activation and recruitment of WNT signaling components, which compensate for the loss of BRD4 and drive resistance in various cancer models. Dynamic ChIP- and STARR-seq enhancer profiles reveal that BET-resistant states are characterized by remodeled regulatory landscapes, involving the activation of a focal MYC enhancer that recruits WNT machinery in response to BET inhibition. Together, our results identify and validate WNT signaling as a driver and candidate biomarker of primary and acquired BET resistance in leukemia, and implicate the rewiring of transcriptional programs as an important mechanism promoting resistance to BET inhibitors and, potentially, other chromatin-targeted therapies. RNA-Seq of DMSO- or JQ1-treated cancer cell lines; ChIP-seq for H3K36me3 and H3K27me3 in a leukemia cell line treated either with DMSO or JQ1, ChIP-seq for H3K27ac in resistant and sensitive mouse and human leukemia. Functional enhancer mapping (STARR-seq) in K-562 treated either with DMSO or JQ1.
Project description:Syk inhibitor demonstrates antiproliferative effect on Tsc2-deficient cells and LAM lung nodules similar to rapamycin. A feedback loop between Syk inhibition and mTORC1 inhibition pathways is also present in these Tsc2-deficient cells. We used microarrays to discern the potential difference in Syk inhibition and mTORC1-inhibition pathways. The goal was to investigate regulatory pathways or targets of Syk inhibition to induce cytocidal response in Tsc2-deficient cells, independent of its crosstalk with mTORC1 signaling.
Project description:To investigate the mechanisms by which SYK inhibition sensitizes OCI-mIDH1/N cells to ivosidenib, we performed RNA sequencing (RNA-seq) analysis of cells treated with DMSO (vehicle control), ivosidenib alone, fostamatinib alone, entospletinib alone, or the combination of ivosidenib with each of the two SYK inhibitors for 9 days.
Project description:Bromodomain and Extra Terminal protein (BET) inhibitors are first-in-class targeted therapies that deliver a new therapeutic paradigm by directly targeting epigenetic readers1,2. Early clinical trials have shown significant promise especially in acute myeloid leukaemia (AML)3; therefore the evaluation of resistance mechanisms, an inevitable consequence of cancer therapies, is of utmost importance to optimise the clinical efficacy of these drugs. Using primary murine stem and progenitor cells immortalised with MLL-AF9, we have used an innovative approach to generate 20 cell lines derived from single cell clones demonstrating stable resistance, in vitro and in vivo, to the prototypical BET inhibitor, I-BET. Resistance to I-BET confers cross-resistance to chemically distinct BET inhibitors such as JQ1, as well as resistance to genetic knockdown of BET proteins. Resistance is not mediated through increased drug efflux or metabolism but is demonstrated to emerge from leukaemia stem cells (LSC). Resistant clones display a leukaemic granulocyte-macrophage progenitor (L-GMP) phenotype (Lin-, Sca-, cKit+, CD34+, Fc³RII/RIII+) and functionally exhibit increased clonogenic capacity in vitro and markedly shorter leukaemia latency in vivo. Chromatin bound BRD4 is globally reduced in resistant cells, however expression of key target genes such as MYC remains unaltered, highlighting the existence of alternative mechanisms to regulate transcription. We demonstrate that resistance to BET inhibitors is in part a consequence of increased Wnt/²-catenin signaling. Negative regulation of this pathway results in differentiation of resistant cells into mature leukaemic blasts, inhibition of MYC expression and restoration of sensitivity to I-BET in vitro and in vivo. Finally, we show that the sensitivity of primary human AML cells to I-BET correlates with the baseline expression of Wnt/²-catenin target genes. Together these findings provide novel insights into the biology of AML, highlight the potential therapeutic limitations of BET inhibitors and identify strategies that may overcome resistance and enhance the clinical utility of these unique targeted therapies. Comparison of iBET resistant and sensitive cell lines
Project description:The five DLBCL cell lines were treated with R406 to assess the signature of SYK inhibition. In previous studies, R406 decreased the proliferation and induced apoptosis of these surface Ig+ cell lines. In the previous studies, R406 inhibited the autophosphorylation of SYK 525/526 and SYK-dependent phosphorylation of BCR signaling components such as BLNK. RNA samples from five DLBCL cell lines treated with R406 or vehicle (DMSO) alone for 0, 6, or 24 hours were profiled in triplicate on Affymetrix HT_HG-U133plust2 chips.