Ontology highlight
ABSTRACT:
PROVIDER: PRJNA544714 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Erythropoietin (EPO) has multiple functions beyond stimulating erythrocytosis, including modulation of T cell immunity. Effects EPO in transplantation and associated mechanisms remain incompletely understood. We analyzed outcomes and performed cellular and molecular mechanistic assessments in murine wild type (WT) and conditional EPO receptor (EPOR) knockout recipients of cardiac allografts. In translational studies, we tested EPO’s effects in a non-human primate system.
2023-03-01 | GSE199270 | GEO
Project description:RNA-Seq of Myf6-knockout versus Wild-type satellite cells
| PRJNA551653 | ENA
Project description:Scaffold Attachment Factor B (SAFB) is a conserved RNA Binding Protein (RBP) that is essential for early mammalian development. However, the RNAs that associate with SAFB in mouse embryonic stem cells have not been characterized. Here, we addressed this unknown using RNA-seq and SAFB RNA immunoprecipitation followed by RNA-seq (RIP-seq) in wild-type mouse embryonic stem cells (ESCs) and in ESCs in which SAFB and SAFB2 were knocked out. The transcript most enriched in SAFB association was the lncRNA Malat1, which contains a series of purine-rich motifs in its 5 end. Beyond Malat1, SAFB predominantly associated with introns of protein-coding genes also through purine-rich motifs. Knockout of SAFB/2 led to down- and upregulation of genes in multiple biological pathways. The nascent transcripts of many downregulated genes associated with high levels of SAFB in wild-type cells, implying that SAFB binding promotes the expression of these genes. Reintroduction of SAFB into double-knockout cells restored gene expression towards wild-type levels, an effect that was again observable at the level of nascent transcripts. Proteomic analyses indicate an enrichment of nuclear speckle-associated, SR proteins in FLAG-tagged SAFB immunoprecipitated samples. Comparison to immunoprecipitates made from FLAG-tagging of another nuclear-enriched RNA-binding protein called HNRNPU (also known as SAF-A) identified both similarities and differences. Perhaps most notably, we observed a stronger enrichment for speckle-associated proteins in SAFB immunoprecipitations and a strong enrichment for paraspeckle-associated proteins in HNRNPU immunoprecipitations. Our findings suggest that among other potential functions in mouse embryonic stem cells, SAFB directly promotes the expression of a subset of genes through its ability to bind purine regions in nascent RNA.
2023-07-20 | PXD038103 | Pride
Project description:RNA-seq of H3.3 knockout and wild type chicken DT40 cells
| PRJEB6738 | ENA
Project description:Cooperative dependencies between mutant oncoproteins and wild-type proteins are critical in cancer pathogenesis and therapy resistance. Although spleen tyrosine kinase (SYK) has been implicated in hematologic malignancies, it is rarely mutated. We used kinase activity profiling to identify collaborators of SYK in acute myeloid leukemia (AML) and determined that FMS-like tyrosine kinase 3 (FLT3) is transactivated by SYK via direct binding. Highly activated SYK is predominantly found in FLT3-ITD positive AML and cooperates with FLT3-ITD to activate MYC transcriptional programs. FLT3-ITD AML cells are more vulnerable to SYK suppression than FLT3 wild-type counterparts. In a FLT3-ITD in vivo model, SYK is indispensable for myeloproliferative disease (MPD) development, and SYK overexpression promotes overt transformation to AML and resistance to FLT3-ITD-targeted therapy.
2014-01-15 | GSE54065 | GEO
Project description:LC-MS/MS analysis of glycopeptides of protein disulfide-isomerase (PDI1), etanercept, erythropoietin (EPO), low affinity immunoglobulin gamma Fc region receptor III-A (FCGR3A), and spike glycoprotein (S) from wild type and Lec1 (GnT1-/-) HEK293 cells
2022-10-14 | PXD032149 | Pride
Project description:RNA-seq wild-type and Cmtm7 knockout TrB-1a
| PRJNA515399 | ENA
Project description:RNA analysis of CRISPR/Cas9 ZNF519 knockout (KO), ZNF441 knockout (KO), ZNF468 knockout (KO) and wild type hESC-derived cortical organoids and ChIP-seq analysis of CRISPR/Cas9 ZNF519 knockout (KO) and wild type hESC-derived cortical organoids, and HEK293 cells with ZNF519 overexpression (OE).
2022-04-25 | GSE201315 | GEO
Project description:Cooperative dependencies between mutant oncoproteins and wild-type proteins are critical in cancer pathogenesis and therapy resistance. Although spleen tyrosine kinase (SYK) has been implicated in hematologic malignancies, it is rarely mutated. We used kinase activity profiling to identify collaborators of SYK in acute myeloid leukemia (AML) and determined that FMS-like tyrosine kinase 3 (FLT3) is transactivated by SYK via direct binding. Highly activated SYK is predominantly found in FLT3-ITD positive AML and cooperates with FLT3-ITD to activate MYC transcriptional programs. FLT3-ITD AML cells are more vulnerable to SYK suppression than FLT3 wild-type counterparts. In a FLT3-ITD in vivo model, SYK is indispensable for myeloproliferative disease (MPD) development, and SYK overexpression promotes overt transformation to AML and resistance to FLT3-ITD-targeted therapy. HL-60, MOLM-14, and U937 cell lines were transduced in triplicate with a control luciferase-directed shRNA (target sequence CCTAAGGTTAAGTCGCCCTCG), and in duplicate with two SYK-directed shRNAs: shSYK_1 (clone ID TRCN0000197257, target sequence GCAGCAGAACAGACATGTCAA) and shSYK_2 (clone ID TRCN0000003163 , target sequence GCAGGCCATCATCAGTCAGAA), and were then selected with 1 µg/ml puromycin 48 hours post-infection. At day 5 post-infection, RNA was extracted and profiled using HT HG-U133A arrays (Affymetrix) at the Broad Institute (Cambridge, MA, USA). The computational analysis of the gene expression data was performed through the Genome Space bioinformatics platform (http://www.genomespace.org).
2014-01-15 | E-GEOD-54065 | biostudies-arrayexpress
Project description:RNA-seq of Sall2 wild-type, heterozygous and knockout MEFs
| PRJNA507759 | ENA