RNA-seq analysis of scramble microPEP(Scr) or microPEP155(P155) treated THP1-derived dendritic cells
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA598109 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:The goals of this study are to compare the clusters and pathways of differential genes in scramble microPEP(Scr) and microPEP155(P155) treated THP1-derived dendritic cells. Methods: THP1-derived DCs were treated with P155 or Scr for 2 h and then treated with R848 (1 µg/ml) for another 2 h. All samples were washed twice with PBS, and total RNA was extracted with RNAiso Plus (Takara Bio) and purified with magnetic oligo (dT) beads after denaturation. Purified mRNA samples were reverse transcribed into fragmented DNA samples and adenylated at the 3’ ends. Adaptors were ligated to construct a library. DNA was quantified by Qubit (Invitrogen). After cBot cluster generation, DNA samples were then sequenced by an Illumina HiSeq X Ten SBS instrument from Genergy Bio (Shanghai). Raw data were converted into Fastq format and transcript per million fragments mapped (FPKM) was calculated and log2 transformed with Cuffnorm. Differential gene transcripts were analyzed with DESeq and enriched for the GO/Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway. Results:RNA-seq data of THP1-derived DCs treated with P155 or Scr revealed that Gene Ontology (GO) pathways mainly involving vesicle-mediated transport and T cell receptor signaling pathway.
2019-12-31 | GSE142711 | GEO
Project description:This study aims to investigate whether circSLC38A1 could affect the enrichment of downstream genes by the transcription factor ILF3.T24 cells were treated with a control scramble (scr) siRNA or a siRNA that specifically knock down the expression of circSLC38A1, 48h after ttansfection, cells were collected and treated for CUT-tag.CUT-tag-Seq analysis provided evidence of ILF3 enrichment of downstream genes changes between si-NC and si-circSLC38A1 T24 cells.
2022-10-01 | GSE186225 | GEO
Project description:The goals of this study are to analyze the DEGs of the spinal cord cells in scramble microPEP(Scr) or microPEP155(P155) treated EAE mouse model. Methods: mononuclear cells of the spinal cord were isolated using Percol™ gradient centrifugation, washed twice with PBS, and total RNA was extracted with RNAiso Plus (Takara Bio) and purified with magnetic oligo (dT) beads after denaturation. Purified mRNA samples were reverse transcribed into fragmented DNA samples and adenylated at the 3’ ends. Adaptors were ligated to construct a library. DNA was quantified by Qubit (Invitrogen). After cBot cluster generation, DNA samples were then sequenced by an Illumina HiSeq X Ten SBS instrument from Genergy Bio (Shanghai). Raw data were converted into Fastq format and transcript per million fragments mapped (FPKM) was calculated and log2 transformed with Cuffnorm. Differential gene transcripts were analyzed with DESeq and enriched for the GO/Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway. Results:Gene Ontology (GO) pathways analysis of RNA-seq data revealed that genes downregulated by P155 treatment were mainly involved in the immune respones signaling pathway.
2019-12-31 | GSE142710 | GEO
Project description:CCAT1-L is a highly expressed long noncoding RNA located in the colorectal cancer specific super enhance region about 500 kb upstream of MYC gene. Knockdown of CCAT1-L significantly down-regulated interaction frequency between CCAT1 and MYC locus and repress MYC expression, suggesting a long-range chromatin interaction between CCAT1-L and MYC locus maintained by CCAT1-L underlie the MYC regulation. To further validate this hypothesis, multiplexed 3C sequencing (3C-seq) was employed to evaluate chromatin interaction strength between CCAT1-L and MYC locus in CCAT1-L knockdown and scramble knockdown (Scr) HT29 cells. The 3C-Seq design and data analysis were performed according to Stadhouders et al, Nat Protoc. 2013, 8:509-524. A series of bait sequences accommodating different locus around CCAT1-L and MYC were selected. Through integrating with specific sample barcodes, bait-specific primer sets were designed to construct relevant 3C-seq libraries in CCAT1-L knockdown and scramble knockdown (Scr) HT29 samples. All of the 3C sample libraries from different treatment, including CCAT1-L knockdown and scramble knockdown (Scr), were then pooled together for high-throughput sequencing. Two technical 3C-seq were performed (CCAT1_myc_3C_1.txt.gz and CCAT1_myc_3C_2.txt.gz) and then combined together to get enough reads for further analysis. 3C-seq reads from different samples were divided according to sample barcodes (CCAT1-L knockdown: ATGTCA; Scr: GCCAAT) and different bait sequences, and then mapped to human reference genome to assess chromatin interaction strength between CCAT1-L and MYC locus in different treatments. In our study, one representative bait-specific sequencing data (CTTCTACTGATTGGCCCTAAACACTTTTCCAAAGCTT) was select to generate bedgraph files and upload to UCSC for visualization to show the chromatin interaction between CCAT1-L and Myc locus in CCAT1-L knockdown (CCAT1-L_knockdown_out.bedgraph) and scramble knockdown (Scr_out.bedgraph) samples.
2014-02-22 | E-GEOD-55261 | biostudies-arrayexpress
Project description:Next Generation Sequencing data of ATAC-Seq library of Thp1-mono, Thp1-macro, and Thp1-M.tb
2022-09-06 | GSE208044 | GEO
Project description:Next Generation Sequencing data of ChIP-seq library of Thp1-mono, Thp1-macro, and Thp1-M.tb
2022-09-06 | GSE208043 | GEO
Project description:RNA-seq analysis of the spinal cord cells in scramble microPEP(Scr) or microPEP155(P155) treated EAE mouse model
| PRJNA598110 | ENA
Project description:We assess the effects of CYR61 treatment on the transcriptome of human THP1 monocytes.
2023-10-18 | GSE233125 | GEO
Project description:CCAT1-L is a highly expressed long noncoding RNA located in the colorectal cancer specific super enhance region about 500 kb upstream of MYC gene. Knockdown of CCAT1-L significantly down-regulated interaction frequency between CCAT1 and MYC locus and repress MYC expression, suggesting a long-range chromatin interaction between CCAT1-L and MYC locus maintained by CCAT1-L underlie the MYC regulation. To further validate this hypothesis, multiplexed 3C sequencing (3C-seq) was employed to evaluate chromatin interaction strength between CCAT1-L and MYC locus in CCAT1-L knockdown and scramble knockdown (Scr) HT29 cells.
2014-02-22 | GSE55261 | GEO
Project description:Macrophages are key cell types of the innate immune system regulating host defense, inflammation, tissue homeostasis and cancer. Within this functional spectrum diverse and often opposing phenotypes are displayed which are dictated by environmental clues and depend on highly plastic transcriptional programs. Among these the ‘classical’ (M1) and ‘alternative’ (M2) macrophage polarization phenotypes are the best characterized. Understanding macrophage polarization in humans may reveal novel therapeutic intervention possibilities for chronic inflammation, wound healing and cancer. Systematic loss of function screening in human primary macrophages is limited due to lack of robust gene delivery methods and limited sample availability. To overcome these hurdles we developed cell-autonomous assays using the THP-1 cell line allowing genetic screens for human macrophage phenotypes. To confirm the relevance of the THP1-based system we performed microarray studies on THP1 cells and primary human cells subjected to various conditions. THP1 cells were treated with PMA (phorbol 12-myristate 13-acetate) to derive macrophages which were then cultured 1, 3 or 6 days with different stimuli.
2017-08-25 | E-MTAB-5917 | biostudies-arrayexpress