HUMAN-VIRUS CHIMERIC PROTEINS GENERATED DURING INFECTION
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA623585 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Existence of human-virus chimeric proteins generated during infection
| PRJNA527980 | ENA
Project description:RNA viruses are a major threat to global human health. The life cycles of many highly pathogenic RNA viruses like influenza A virus (IAV) and Lassa virus depends on host mRNA, as viral polymerases cleave 5′m7G-capped host transcripts to prime viral mRNA synthesis (‘cap-snatching’). We hypothesized that start codons within cap-snatched host transcripts could drive the expression of chimeric human-viral coding sequences. Here, we report the existence of this mechanism of gene origination (‘start-snatching’), which creates, depending on the translatability of the viral UTRs, human-virus protein chimeras either as N-terminally extended viral proteins or entirely novel polypeptides by genetic overprinting. We show that both types of chimeric proteins are made in IAV-infected cells, can generate T cell responses and contribute to virulence. Our results indicate that IAV, and likely a multitude of other human-, animal- and plant-viruses, use this host-dependent mechanism to expand their proteome diversity during infection.
2020-05-15 | GSE148245 | GEO
Project description:Influenza A virus (IAV) is a threat to mankind because it generates yearly epidemics and poorly predictable sporadic pandemics with catastrophic potential. Influenza has a small RNA genome (~14 Kb) composed of 8 mini-chromosomes (segments). Segments encode both structural proteins and proteins expressed only during infection. Segments are constituted by a 5’UTR followed by a coding region and a 3’UTR. Transcription of IAV RNA into mRNA depends on host RNA Polymerase II, as the viral polymerase cleaves 5’ capped cellular nascent transcripts to be used as primers to initiate mRNA synthesis. We hypothesized that host nascent transcripts bearing AUG could generate upstream ORFs in the viral segments, a phenomenon that would depend on the translatability of the viral 5’UTRs. Using orthogonal datasets we report the existence of this mechanism, which generate host-virus chimeric proteins. We show that most segments encode proteins in this manner, expanding the proteome diversity of IAV in infected cells. Host-virus chimeric proteins are conserved across IAV strains, pointing to an evolutionary conservation of function achieved by sampling of the evolutionary space before gene fixation. Thus, we discover a mechanism that generate human-virus chimeric proteins during infection.
2020-06-25 | GSE128519 | GEO
Project description: Not available
| S-EPMC7323901 | biostudies-literature
Project description:We generated human liver chimeric mice that were repopulated with human hepatocytes and we infected them for 11 weeks with Hepatitis B virus (HBV). Hepatocytes were isolated from the infected chimeric mouse livers and their gene expressions were compared with those from uninfected chimeric mice using RNA-sequencing.
2020-05-22 | GSE145835 | GEO
Project description:Cross-species comparative analysis of Dicer proteins during Sindbis virus infection
| PRJNA266231 | ENA
Project description:AGO protein immunoprecipitation was combined with high-throughput sequencing of associated small RNAs. AGO2, AGO10, and to a lesser extent AGO1 were shown to associate with siRNAs derived from silencing suppressor (HC-Pro)-deficient TuMV-AS9, but not with siRNAs derived from wild-type TuMV. Co-immunoprecipitation and small RNA sequencing revealed that viral siRNAs broadly associated with wild-type HC-Pro during TuMV infection. These results support the hypothesis that suppression of antiviral silencing during TuMV infection, at least in part, occurs through sequestration of virus-derived siRNAs away from antiviral AGO proteins by HC-Pro.
2015-04-06 | GSE64911 | GEO
Project description:To investigate the virological properties of a SARS-CoV-2 variant, Omicron BA.2, we generated chimeric recombinant viruses that express GFP and encodes the S gene of B.1.1 (ancestral D614G-bearing virus), Delta, BA.1 and BA.2. To verify the genome sequence of the working viruses, we performed viral RNA-sequencing of the viral stock.
2022-02-16 | GSE196649 | GEO
Project description:The role of RNA silencing as a defense mechanism against viruses remains to be formerly established in mammalian somatic cells. Here, we determined the antiviral properties of human and Drosophila Dicer proteins in a heterologous setup. We expressed human Dicer (hDicer) in Drosophila, and Drosophila Dicer-2 in human cells, and measured the impact on the response to Sindbis virus (SINV) infection. In flies, hDicer presents a low processing activity, but partially rescues a Dcr2 null mutation in flies. Expression of Dicer-2 in HEK293 cells allows the processing of SINV RNA into 21-nt-long small RNAs. Nevertheless, instead of conferring a protective effect against SINV, Dicer-2 expression increases viral replication in HEK293 cells. We present evidence that this effect is due to a competition with the interferon pathway. Our results therefore suggest that adding functionial RNA silencing machinery in IFN-competent differentiated mammalian cells can be detrimental for antiviral defense.
2015-12-28 | GSE62934 | GEO
Project description:AGO protein immunoprecipitation was combined with high-throughput sequencing of associated small RNAs. AGO2, AGO10, and to a lesser extent AGO1 were shown to associate with siRNAs derived from silencing suppressor (HC-Pro)-deficient TuMV-AS9, but not with siRNAs derived from wild-type TuMV. Co-immunoprecipitation and small RNA sequencing revealed that viral siRNAs broadly associated with wild-type HC-Pro during TuMV infection. These results support the hypothesis that suppression of antiviral silencing during TuMV infection, at least in part, occurs through sequestration of virus-derived siRNAs away from antiviral AGO proteins by HC-Pro. Catalytic mutant HA-AGO1-DAH, HA-AGO2-DAD and HA-AGO10-DAH or catalytically active HA-AGO10-DDH were immunoprecipitated from buffer (mock) or inoculated rosette leaves (at 7 dpi) or noninoculated cauline leaves at 10 dpi with wt TuMV or suppressor-deficient TuMV-AS9. Inflorescence from TuMV infected plants was collected at 10 dpi with wt TuMV. HC-Pro was tagged with 6xHIS in TuMV-HIS and suppressor-deficient TuMV-HIS-AS9. HC-Pro was immunoprecipitated from noninoculated cauline leaves of inflorescence at 10 dpi. HC-Pro AS9 was immunoprecipitated from noninoculated cauline leaves at 15 dpi. Total RNA was extracted from input fraction and small RNAs separated by size fractionation. Small RNAs in input and HA-AGO or HC-Pro immunoprecipitation fractions were converted to DNA Amplicons by 5' (GUUCAGAGUUCUACAGUCCGACGAUC) or 3’ (CTGTAGGCACCATCAAT) adaptor ligation followed by RT-PCR. DNA Amplicons were sequenced using the Illumina HiSeq2000 platform. Duplicate libraries were made per treatment. For each library, hits to TuMV, to TuMV-HIS and to Arabidopsis thaliana were included in separate files.
2015-04-06 | E-GEOD-64911 | biostudies-arrayexpress