Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

NTP4 modulates miRNA accumulation via asymmetric modification of miRNA-3p/5p duplex

ABSTRACT: NTP4 modulates miRNA accumulation via asymmetric modification of miRNA-3p/5p duplex

PROVIDER: PRJNA634468 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Similar Datasets

NTP4 modulates miRNA accumulation via asymmetric modification of miRNA-3p/5p duplex

Project description:Arabidopsis uridylyltransferase on unmethylated sRNAs and directed their degradation. Here, the small RNA deep sequencing of the uridylyltransferase mutants of Arabidopsis were performed, which include Col-0, heso1-1, urt1-1, ntp4-1.

2020-05-23 | GSE151036 | GEO

RNAi knock down of miR-30a-3p in human HepG2 cells to identify the target transcripts against miR-30a-3p in vivo

Project description:Human miR-30a-3p was knocked-down in HepG2 using siRNA duplex against the miRNA precursor, and compared to control cells on GeneChip to identify the target transcripts against miR-30a-3p in vivo.

2006-01-01 | E-MEXP-456 | biostudies-arrayexpress

PETACC-8 miR-31-3p and miR-31-5p Ancillary Study

Project description:This is a prospective-retrospective study to determine if the expression of the miRNA’s miR-31-3p and miR-31-5p are prognostic of patient outcomes or predictive of the benefit from anti-EGFR therapy in stage III Colon Cancer. The present study will utilize FFPE tumor samples collected from patients enrolled in the PETACC-8 study conducted by the Fédération Francophone de Cancérologie Digestive (FFCD). This phase 3 clinical trial prospectively randomized fully resected stage III colon cancer patients to receive adjuvant treatment with either FOLFOX-4 plus cetuximab or FLOFOX-4 alone.

| 2260465 | ecrin-mdr-crc

Pediastrum duplex

Project description:Pediastrum duplex overview

| PRJNA317025 | ENA

Impact of miR-199-5p, miR-199a-3p and miR-214-3p overexpression on human lung fibroblasts

Project description:To identify putative novel specific targets of miR-199-5p, miR-199a-3p and miR-214-3p, we overexpressed these miRNAs in human MRC5 pulmonary fibroblasts (CCL-171) using synthetic pre-miRNAs or a synthetic “negative” pre-miRNA control (miR-Neg). RNA samples were harvested 48 hours post-transfection and 3 independent experiments were carried out.

2019-04-11 | GSE97824 | GEO

Gene expression analysis of THP-1 cells (monocytic cell line) transfected with microRNA mimics: let-7d-3p, let-7e-5p,miR-146a-5p,miR-130a-3p, miR-151a-3p.

Project description:In our previous study, hsa-let-7d-3p, hsa-let-7e-5p,hsa-miR-146a-5p,hsa-miR-130a-3p, hsa-miR-151a-3p,were significantly upregulated in the plasma of atopic patients. To study the each function of let-7d-3p, let-7e-5p,miR-146a-5p,miR-130a-3p, miR-151a-3p which are significantly upregulated in the plasma of atopic patients, we performed mimic-transfected THP-1 cells, a mononuclear cell line, and performed comprehensive genetic analysis.

2023-02-06 | GSE217971 | GEO

Gene expression profiling of MDA-MB-231 cells transfected with hsa-miR-205-5p and hsa-miR-214-3p compared to scrambled miRNA precursors

Project description:We have employed whole genome microarray to identify changes in gene expression in MDA-MB-231 cells transfected with hsa-miR-205-5p and hsa-miR-214-3p compared to scrambled miRNA precursors at 72 hours after transfection.

2020-05-31 | GSE148847 | GEO

Manipulation of Mir140 3p and 5p expression

Project description:The goal of this study was to change the stoichiometry of Mir140-3p and Mir140-5p expression, thereby increasing the expression levels of Mir140-5p, and observe the biological effects on skeletal development. This was done by introducing two types of nucleotide changes into the seed regions of Mir140. The first was by changing the initial bases of Mir140-3p from 'TACCACAGGGTAGAACCACGGACAGGGTACTGGAGC' to 'CGCCACAGGGTAGAACCACGGACAGGGTACTGGAGC' lowering the expression levels of Mir140 3p and disrupting its function. The second change to alter Mir140 expression was by changing the Mir140-5p seed region from 'CAGTGGTTTTACCCTATGGAGG' to 'TAGTGGTTTTACCCTATGGAGG' increasing mi140-5p's ability to be bound by Argonaute.

2020-11-28 | GSE162266 | GEO

Transcriptomic analysis of hepatocellular carcinoma cell lines HepG2 treated with Sorafenib and transfected with miR-200c-3p inhibitor, and miR-222-5p and miR-512-3p mimics

Project description:Hepatocellular carcinoma (HCC) is one of the most common causes of death worldwide and the fourth most prevalent type of cancer. Whereas curative treatments such as liver transplantation, ablation or surgery are optimal for early stages, only paliative treatments are given to intermediate and advanced stages of the disease. Despite the introduction of immune regulators as first-line treatments for advanced stages, Sorafenib is still the standard of care in the clinical practice. In cell lysates, anti-tumoral properties of Sorafenib were related to upregulation of miR-200c-3p (anti-tumoral miRNA) at 6 hours of treatment and downregulation of miR-222-5p and miR-512-3p (pro-tumoral miRNAs) at 24 hours. We have identified these miRNA biomarkers of Sorafenib treatment response in plasma of patients with advanced HCC treated with Sorafenib. In particular, miR-200c-3p has been related to increased survival benefit whereas miR-222-5p and miR-512-3p have been related to worse prognosis. Our study has sequenced HepG2 cells treated with Sorafenib and miR-200c-3p inhibitor, and transfected with miR-222-5p and miR-512-3p mimics to unravel the molecular pathways governing Sorafenib response

2022-04-28 | GSE201695 | GEO

Impaired AGO2/miR-185-3p/NRP1 Axis Promotes Colorectal Cancer Metastasis

Project description:Increasing evidence suggests that global downregulation of miRNA expression is a hallmark of human cancer, potentially due to defects in the miRNA processing machinery. In this study, we found that the protein expression of Argonaute 2 (AGO2), a key regulator of miRNA processing, was downregulated in colorectal cancer (CRC) tissues, which was also consistent with the findings of the Clinical Proteomic Tumor Analysis Consortium (CPTAC). Furthermore, the correlation between the levels of AGO2 and epithelial-mesenchymal transition (EMT) markers (E-cadherin and vimentin) indicated that reduced levels of AGO2 promoted EMT in CRC. Low expression of AGO2 was an indicator of a poor prognosis among CRC patients. Knockdown of AGO2 in CRC cells promoted migration, invasion and metastasis formation in vitro and in vivo but had no influence on proliferation. To provide detailed insight into the regulatory roles of AGO2, we performed integrated transcriptomic, quantitative proteomic and microRNA sequencing (miRNA-seq) analyses of AGO2 knockdown cells and the corresponding wild-type cells and identified neuropilin 1 (NRP1) as a new substrate of AGO2 via miR-185-3p. Our data provided evidence that knockdown of AGO2 resulted in a reduction of miR-185-3p expression, leading to the upregulation of the expression of NRP1, which is a direct target of miR-185-3p, and elevated CRC cell metastatic capacity. Inhibition of NRP1 or treatment with a miR-185-3p mimic successfully rescued the phenotypes of impaired AGO2, which suggested that therapeutically targeting the AGO2/miR-185-3p/NRP1 axis may be a potential treatment approach for CRC.

2021-02-11 | PXD024171 | iProX

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data