Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.
Project description:Microplastics (MPs) as widespread contamination pose high risk for aquatic organisms.Intestinal microbiotahas have high interaction with immune system of host body. In this study, intestinal microbiota of zebrafish after Polystyrene (PS-MPs) exposure were characterized by 16S rDNA amplicon sequencing. We found that 100nm and 200μm PS-MPs exposure significantly increased diversity of intestinal microbiota and all the three sizes of PS-MPs increased abundance of pathogenic bacteria.
Project description:Prostate of SD rats was injected with 0.1 ml 1% carrageenan to induce chronic nonbacterial prostatitis, and the control rats injected with sterile saline. Then, the cecal contents were collected for 16S rDNA sequencing.
2021-07-07 | GSE179639 | GEO
Project description:16S high throughput sequencing
