Project description:4C procedure was used for analysis of genomic contacts of rDNA units in HEK 293T cells. The primers for 4C were selected downstream from EcoRI site at coordinate 30487 in rDNA sequence with Accession number U13369.1.
Project description:4C-rDNA procedure was used for analysis of genomic contacts of rDNA units in hESM01 cells. The primers for 4C were selected downstream from EcoRI site at coordinate 30487 in rDNA sequence with Accession number U13369.1.
Project description:4C-rDNA procedure was used for analysis of genomic contacts of rDNA units in HEK 293T cells. The primers for 4C were selected downstream from EcoRI site at coordinate 30487 in rDNA sequence with Accession number U13369.1.
Project description:4C-rDNA procedure was used for analysis of genomic contacts of rDNA units in HEK 293T cells. The primers for PCR amplification were selected upstream from EcoRI site (coordinate 30487 in the sequence with Accession number U13369.1): 5' TTCGCCTACGGATTTCTAGAAAATAA 3' and 5' AAAAGAAGCTCAAGTACATCTAATCTAA 3' (new primers).
Project description:We showed previously that insertion of Synechocystis 12-desaturase in Salmonellas membrane alters membrane physical state (MPS) followed by the expression of stress genes causing inability to survive within murine macrophages . Recently, we showed that expression of one membrane lipid domain (MLD) of 12-desaturase (ORF200) interferes with Salmonella MPS causing loss of virulence in mice and immunoprotection. We postulated that a putative -AMP intercalates specifically within phospholipids but, depending on its amino acid sequence, does so within particular key sensors of MLD. In this study we choose as target for a putative synthetic AMP, PhoP/PhoQ, a sensor that responds to low Mg2+ concentration during murine macrophages infection. We synthesized a modified DNA fragment coding for an amino acid sequence (NUF) similar to that fragment and expressed it in Salmonella LT2 strain. We show that the pattern of gene expression controlled by PhoP/PhoQ and other pathways involving phospholipids biosynthesis, stress proteins and genes coding for antigens are dysregulated. We also present RNAseq of strain expressing ORF200 and showed that the pattern of the same genes is altered. Accumulation of NUF conferred temporary immunoprotection suggesting that it is possible to address a synthetic peptide to a specific MLD. This represents a powerful procedure to synthesize -AMPs and generate live non virulent strains for vaccination.
Project description:Whole exome sequencing of 5 HCLc tumor-germline pairs. Genomic DNA from HCLc tumor cells and T-cells for germline was used. Whole exome enrichment was performed with either Agilent SureSelect (50Mb, samples S3G/T, S5G/T, S9G/T) or Roche Nimblegen (44.1Mb, samples S4G/T and S6G/T). The resulting exome libraries were sequenced on the Illumina HiSeq platform with paired-end 100bp reads to an average depth of 120-134x. Bam files were generated using NovoalignMPI (v3.0) to align the raw fastq files to the reference genome sequence (hg19) and picard tools (v1.34) to flag duplicate reads (optical or pcr), unmapped reads, reads mapping to more than one location, and reads failing vendor QC.
Project description:Purpose: The goal of this study is to compare endothelial small RNA transcriptome to identify the target of OASL under basal or stimulated conditions by utilizing miRNA-seq. Methods: Endothelial miRNA profilies of siCTL or siOASL transfected HUVECs were generated by illumina sequencing method, in duplicate. After sequencing, the raw sequence reads are filtered based on quality. The adapter sequences are also trimmed off the raw sequence reads. rRNA removed reads are sequentially aligned to reference genome (GRCh38) and miRNA prediction is performed by miRDeep2. Results: We identified known miRNA in species (miRDeep2) in the HUVECs transfected with siCTL or siOASL. The expression profile of mature miRNA is used to analyze differentially expressed miRNA(DE miRNA). Conclusions: Our study represents the first analysis of endothelial miRNA profiles affected by OASL knockdown with biologic replicates.
