CRAC of Nab3 in yeast cells accumulating a circular RNA containing Nab3 binding sites (the decoy) or an empty control
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA691262 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:We report the analysis of in vivo, genomewide binding of Nab3 under conditions in which non-degradable targets of Nab3 accumulate. We aimed at mimicking the effect of defective degradation of non-coding RNAs (Cryptic Unstable Transcripts, CUT) that can be bound by Nab3 on the co-transcriptional recruitment of Nab3 for transcription termination.
2021-01-12 | GSE164587 | GEO
Project description:RNA-binding proteins play a key role in shaping gene expression profiles during stress, however, little is known about the dynamic nature of these interactions and how this influences the kinetics of gene expression. To address this, we developed kinetic χCRAC, a UV cross-linking method that enabled us to quantitatively measure the dynamics of protein-RNA interactions in vivo on a minute time-scale. Here, using kinetic χCRAC we measure the global RNA-binding dynamics of the yeast transcription termination factor Nab3 in response to glucose starvation. These measurement reveal rapid changes in protein-RNA interactions within one minute following stress imposition. Changes in Nab3 binding are largely independent of alterations in transcription rate during the early stages of stress response, indicating orthogonal transcriptional control mechanisms. We also uncover a function for Nab3 in dampening expression of stress-responsive genes. Kinetic χCRAC has the potential to greatly enhance our understanding of in vivo dynamics of protein-RNA interactions.
2017-04-11 | GSE85545 | GEO
Project description: Not available
| S-EPMC8020422 | biostudies-literature
Project description:We obtained Nab3, Nrd1, and RNA polymerase II occupancy profiles across the genome of S.cerevisiae in wild-type and rrp6∆ strains. This allowed us to determine the impact of defective nuclear exosome on NNS-dependent transcription termination.
2020-07-24 | GSE137881 | GEO
Project description:Nrd1 and Nab3 are two yeast RNA binding proteins which have been shown to be involved in transcription termination of non poly(A) genes. We have used expression profiling of a Nab3 mutant to discover novel RNA targets of the Nrd1 and Nab3 transcription termination pathway. Failure to terminate RNA polymerase II by Nab3 leads to continued transcription well beyond the correct termination sites, altering the expression of adjacent downstream genes. Using this concept, our microarray uncovered the up-regulation of numerous genes that are located downstream of “cryptic unstable transcripts”, transcripts that are transcribed, terminated and rapidly degraded by Nrd1, Nab3, and the nuclear exosome. Keywords: yeast temperature sensitive mutant 25C vs 37C
2006-05-30 | GSE4657 | GEO
Project description:Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do). genetic_modification_design
2012-08-23 | E-GEOD-39572 | biostudies-arrayexpress
Project description:Nrd1 and Nab3 are two yeast RNA binding proteins which have been shown to be involved in transcription termination of non poly(A) genes. We have used expression profiling of a Nab3 mutant to discover novel RNA targets of the Nrd1 and Nab3 transcription termination pathway. Failure to terminate RNA polymerase II by Nab3 leads to continued transcription well beyond the correct termination sites, altering the expression of adjacent downstream genes. Using this concept, our microarray uncovered the up-regulation of numerous genes that are located downstream of âcryptic unstable transcriptsâ, transcripts that are transcribed, terminated and rapidly degraded by Nrd1, Nab3, and the nuclear exosome. Experiment Overall Design: Four yeast total RNA samples where analyzed in this study. These RNAs come from two separate strains of yeast, each strain at either the permissive temperature (25C) or the non-permissive temperature (37C). One of these strains is a wild type strain of yeast used as a control. The other strain has a mutation in the Nab3 protein that confers temperature sensitivity at the non-permissive temperature of 37C. After two hours at the non-permissive temperature, we observe disruptions in the Nrd1/Nab3 transcription termination pathway and this is the scheme that we followed for our microarray experiment. Our goal was to observe the global expression changes after 2 hours without Nab3 function.
2008-06-13 | E-GEOD-4657 | biostudies-arrayexpress
Project description:Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do).
2012-08-23 | GSE39572 | GEO
Project description:Termination of yeast RNA polymerase II (Pol II) transcripts occurs through two alternative pathways. Termination of mRNAs is coupled to cleavage and polyadenylation while non-coding transcripts are terminated through the Nrd1-Nab3-Sen1 (NNS) pathway in a process that is linked to RNA degradation by the nuclear exosome. Some mRNA transcripts are also attenuated through premature termination directed by the NNS complex. In this paper we present the results of nuclear depletion of the NNS component Nab3. As expected many non-coding RNAs fail to terminate properly. In addition, we observe that nitrogen catabolite repressed genes are up-regulated by Nab3 depletion.
2017-07-12 | GSE97345 | GEO