Genetic studies of human-chimpanzee divergence using stem cell fusions
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA766089 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Complete genome sequencing has identified millions of DNA changes that differ between humans and chimpanzees. Although a subset of these changes likely underlies important phenotypic differences between humans and chimpanzees, it is currently difficult to distinguish causal from incidental changes and to map specific phenotypes to particular genome locations. To facilitate further genetic study of human-chimpanzee divergence, we have generated human and chimpanzee auto-tetraploids and allo-tetraploids by fusing induced pluripotent stem cells (iPSCs) of each species. The resulting tetraploid iPSCs can be stably maintained and retain the ability to differentiate along ectoderm, mesoderm, and endoderm lineages. RNA sequencing identifies thousands of genes whose expression differs between humans and chimpanzees when assessed in single-species diploid or auto-tetraploid iPSCs. Analysis of gene expression patterns in inter-specific allo-tetraploid iPSCs shows that human-chimpanzee expression differences arise from substantial contributions of both cis-acting changes linked to the genes themselves, and trans-acting changes elsewhere in the genome. To enable further genetic mapping of species differences, we tested chemical treatments for stimulating genome-wide mitotic recombination between human and chimpanzee chromosomes, and CRISPR methods for inducing species-specific changes on particular chromosomes in allo-tetraploid cells. We successfully generated derivative cells with nested deletions or inter-specific recombination on the X chromosome. These studies identify a long distance cis-regulatory domain of the Fragile X-associated gene (FMR1), confirm an important role for the X chromosome in trans-regulation of other expression differences, and illustrate the potential of this system for more detailed mapping of the molecular basis of human and chimpanzee evolution.
2021-11-29 | GSE184768 | GEO
Project description: Not available
| S-EPMC8713981 | biostudies-literature
Project description:Gene regulatory divergence is thought to play a central role in determining human-specific traits. However, our ability to link divergent regulation to divergent phenotypes is limited. Here, we utilized human-chimpanzee hybrid induced pluripotent stem cells to study divergent gene expression separating these species. The hybrid cells allowed us to separate cis- from trans-regulatory effects, and to control for non-genetic factors that often confound comparative studies. We differentiated these cells into cranial neural crest cells (CNCCs), the primary cell type giving rise to the face, and used the hybrid cells to generate a catalogue of divergent cis-regulatory gene expression between humans and chimpanzees. We found that cis-regulatory divergence is tightly linked to phenotypic divergence, enabling the identification of candidate genes associated with several divergent traits. Specifically, we find support for lineage-specific selection acting on the cis-regulation of the hedgehog signaling pathway. This pathway includes EVC2 (LIMBIN), whose cis-regulation is among the most divergent in the genome, resulting in 6-fold down-regulation along the human lineage. We found that inducing a similar reduction in EVC2 levels substantially reduces Hh signaling output. Mice and humans lacking functional EVC2 show striking parallels to many human-chimpanzee phenotypic differences, particularly in the skull and face, suggesting that the regulatory divergence of Hh signaling may have contributed to the unique craniofacial morphology of humans. In sum, our results suggest that human-chimpanzee hybrid cells can serve as a valuable resource to study the evolution of gene regulation and its impact on phenotypic divergence. SRA/fastq files include Illumina adapters (GATCGGAAGAGCACACGTCT and GATCGGAAGAGCGTCGTGTA).
2020-10-09 | GSE146481 | GEO
Project description:Here we derive human and chimpanzee cranial neural crest cells (CNCCs) and profile histone modifications, transcription factors, chromatin accessibility and gene expression to systematically and quantitatively annotate evolutionary divergence of craniofacial cis-regulatory landscapes.
2015-09-11 | GSE70751 | GEO
Project description:Here we derive human and chimpanzee cranial neural crest cells (CNCCs) and profile histone modifications, transcription factors, chromatin accessibility and gene expression to systematically and quantitatively annotate evolutionary divergence of craniofacial cis-regulatory landscapes. Histone modifications (H3K27ac, H3K4me1, H3K4me3, H3K27me3), chromatin modifiers (p300), transcription factors (NR2F1, TFAP2A), chromatin accessibility (ATACseq) and gene expression (RNAseq) were assayed in CNCCs derived from iPSCs/ESCs from 2 chimpanzee and 3 human individuals.
2015-09-11 | E-GEOD-70751 | biostudies-arrayexpress
Project description:Although gene expression divergence has long been postulated to be the primary driver of human evolution, identifying the genes and genetic variants underlying uniquely human traits has proven to be quite challenging. Theory suggests that cell type-specific cis-regulatory variants may fuel evolutionary adaptation due to the specificity of their effects. These variants can precisely tune the expression of a single gene in a single cell type, avoiding the potentially deleterious consequences of trans-acting changes and non-cell type-specific changes that can impact many genes and cell types, respectively. It has recently become possible to quantify human-specific cis-acting regulatory divergence by measuring allele-specific expression in human-chimpanzee hybrid cells—the product of fusing induced pluripotent stem (iPS) cells of each species in vitro. However, these cis-regulatory changes have only been explored in a limited number of tissues and cell types. Here, we quantify human-chimpanzee cis-regulatory divergence in gene expression and chromatin accessibility across six cell types, enabling the identification of highly cell type-specific cis-regulatory changes. We find that cell type-specific genes and regulatory elements evolve faster than those shared across cell types. Furthermore, we identify several instances of lineage-specific natural selection that may have played key roles in specific cell types, such as coordinated changes in the cis-regulation of dozens of genes involved in neuronal firing in motor neurons. Finally, using novel metrics and a machine learning model, we identify genetic variants that likely alter chromatin accessibility and transcription factor binding, leading to neuron-specific changes in the expression of the neurodevelopmentally important genes FABP7 and GAD1. Overall, our results demonstrate that integrative analysis of cis-regulatory divergence in chromatin accessibility and gene expression across cell types is a promising approach to identify the specific genes and genetic variants that make us human.
2023-05-23 | GSE232948 | GEO
Project description:Although gene expression divergence has long been postulated to be the primary driver of human evolution, identifying the genes and genetic variants underlying uniquely human traits has proven to be quite challenging. Theory suggests that cell type-specific cis-regulatory variants may fuel evolutionary adaptation due to the specificity of their effects. These variants can precisely tune the expression of a single gene in a single cell type, avoiding the potentially deleterious consequences of trans-acting changes and non-cell type-specific changes that can impact many genes and cell types, respectively. It has recently become possible to quantify human-specific cis-acting regulatory divergence by measuring allele-specific expression in human-chimpanzee hybrid cells—the product of fusing induced pluripotent stem (iPS) cells of each species in vitro. However, these cis-regulatory changes have only been explored in a limited number of tissues and cell types. Here, we quantify human-chimpanzee cis-regulatory divergence in gene expression and chromatin accessibility across six cell types, enabling the identification of highly cell type-specific cis-regulatory changes. We find that cell type-specific genes and regulatory elements evolve faster than those shared across cell types. Furthermore, we identify several instances of lineage-specific natural selection that may have played key roles in specific cell types, such as coordinated changes in the cis-regulation of dozens of genes involved in neuronal firing in motor neurons. Finally, using novel metrics and a machine learning model, we identify genetic variants that likely alter chromatin accessibility and transcription factor binding, leading to neuron-specific changes in the expression of the neurodevelopmentally important genes FABP7 and GAD1. Overall, our results demonstrate that integrative analysis of cis-regulatory divergence in chromatin accessibility and gene expression across cell types is a promising approach to identify the specific genes and genetic variants that make us human.
2023-05-23 | GSE232947 | GEO
Project description:Human-chimpanzee hybrid cells reveal gene regulatory evolution underlying skeletal divergence
| PRJNA610639 | ENA
Project description:Enhancer divergence and cis-regulatory evolution in the human and chimpanzee neural crest
| PRJNA289483 | ENA
Project description:The interplay between phenotypic plasticity and adaptive evolution has long been an important topic of evolutionary biology. This process is critical to our understanding of a species evolutionary potential in light of rapid climate changes. Despite recent theoretical work, empirical studies of natural populations, especially in marine invertebrates, are scarce. In this study, we investigated the relationship between adaptive divergence and plasticity by integrating genetic and phenotypic variation in Pacific oysters from its natural range in China. Genome resequencing of 371 oysters revealed unexpected fine-scale genetic structure that is largely consistent with phenotypic divergence in growth, physiology, thermal tolerance and gene expression across environmental gradient. These findings suggest that selection and local adaptation are pervasive and together with limited gene flow shape adaptive divergence. Plasticity in gene expression is positively correlated with evolved divergence, indicating that plasticity is adaptive and likely favored by selection in organisms facing dynamic environments such as oysters. Divergence in heat response and tolerance implies that the evolutionary potential to a warming climate differs among oyster populations. We suggest that trade-offs in energy allocation are important to adaptive divergence with acetylation playing a role in energy depression under thermal stress.
2018-07-27 | PXD008057 | Pride