SOX1OT V1 Acts as a Decoy of HDAC10 to Promote SOX1-dependent hESC Neuronal Differentiation
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA773048 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:To investigate the mechanism by which SOX1-OT V1 regulates neural differentiation, The sample from d0, d4, d10, d16D (dorsal) and d16V (ventral) of neural differentiation were collected to perform RNA-seq assays to quantitate gene expression in control group and SOX1-OT V1-PAKI group.
2021-10-26 | GSE186233 | GEO
Project description: Not available
| S-SCDT-EMBOR-2021-53015V1 | biostudies-other
Project description:To understand how SOX1's binding profile in neural progenitor with different regional identities, we differentiated hESC into neural progenitors with rostral and caudal identies throught modulating Wnt signaling pathway. We collected cells at neural differentiation day 4 and 8, and performed SOX1 ChIP-seq to investigate SOX1's genome wide binding profiles. These results provide important information for the mechanism underlying SOX1's functions in early regionalization.
2020-08-26 | GSE138215 | GEO
Project description:During human embryogenesis, primitive neural cells start to be generated at the time of gastrulation and gradually acquire regional identities, which is a process called neural patterning. But how intrinsic factors respond to exogenous patterning signals remains poorly understood. Human Embryonic Stem Cells (hESCs) provide a great model to recapitulate this process. Through exogenous manipulation of canonical WNT signaling activation during neural differentiation, dose-dependent specification of regionally defined neural progenitors ranging from the telencephalic forebrain to posterior hindbrain could be rapidly and efficiently induced. Unexpectedly, we find that SOX1, generally referred as a pan-neural gene, displays a regional specific distribution in the human neural patterning process. To investigate the expression and function of SOX1 efficiently, we have generated the SOX1-EGFP reporter and SOX1-knockout (KO) hESC lines using the CRISPR/Cas9 system. SOX1 is initially expressed across the mes–met border and peaked in the metencephalon region at the early regional specification stage. Its depletion leads to the posterior shift of the mes–met border. Therefore, SOX1 is required to define the border at a correct region. In-depth analysis of SOX1 ChIP-sequencing and transcriptome data will provide more insights into how SOX1 determines the mes-met border formation and identify the downstream targets of SOX1. This study identifies SOX1 as one of the intrinsic factors key for the prepattern establishment in the developing central nervous system, particularly for defining the isthmus position.
2020-08-26 | GSE138217 | GEO
Project description:Competitive hybridization of V1 variant of genome sequenced C. jejuni strain 11168 versus V1 variant in which flhA gene has been disrupted. Keywords: repeat sample
2004-03-03 | GSE530 | GEO
Project description:Competive hybridization of V1 variant of genome sequenced C. jejuni strain 11168 versus V1 variant in which fliA gene encoding sigma 28 has been disrupted Keywords: repeat sample
2004-03-03 | GSE521 | GEO
Project description:Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do). genetic_modification_design
2012-08-23 | E-GEOD-39572 | biostudies-arrayexpress
Project description:Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do).
2012-08-23 | GSE39572 | GEO
Project description:With this study we aimed to characterize the changes invoked in glial progenitor cells by activation of the endogenous copy of the master transcription factor Sox1. For this study, a progenitor cell line was derived from ES cells carrying a heterozygous GFP knock-in in the Sox1 ORF. Sox1 positive cells were identified by GFP expression, and separated by FACS. As control population, Sox1 negative progenitors were used, as well as GFP sorted and unsorted, Sox1 positive Neuroepithelial cells derived from the same ES cell line.
2019-04-18 | GSE119480 | GEO
Project description:The dentate gyrus of the hippocampus continues generating new neurons throughout life. These nerve cells originate from radial astrocytes within the subgranular zone (SGZ). We find that Sox1, a member of the SoxB1 family of transcription factors, is expressed in a subset of radial astrocytes. Lineage tracing using Sox1 driven reporter mice shows that the Sox1-expressing cells represent an activated neural stem/progenitor population. We used microarrays to evaluate the molecular constitution of neural stem cells with aging.
2012-08-09 | GSE39992 | GEO